Mutagenetix > Incidental Mutation

Incidental Mutation 'R8214:Kidins220'

636321

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

067656-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8214 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25024924-25113151 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 25044854 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 216 (T216I)

Ref Sequence

ENSEMBL: ENSMUSP00000063999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652]

AlphaFold

E9Q9B7

Predicted Effect

probably damaging
Transcript: ENSMUST00000066652
AA Change: T216I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: T216I

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,177,447 (GRCm39)	R52Q		Het
Abcc3	C	T	11: 94,254,344 (GRCm39)	R718H	probably damaging	Het
Abcc4	T	C	14: 118,738,253 (GRCm39)	M1166V	probably benign	Het
Abhd16b	C	T	2: 181,135,983 (GRCm39)	T295I	probably damaging	Het
Amph	A	G	13: 19,288,468 (GRCm39)	N319S	possibly damaging	Het
Ankrd27	A	G	7: 35,313,944 (GRCm39)	D425G	probably damaging	Het
Atg4b	T	C	1: 93,712,609 (GRCm39)	S316P	probably damaging	Het
Brd4	A	G	17: 32,431,921 (GRCm39)	S649P	probably benign	Het
Bzw1	T	C	1: 58,444,196 (GRCm39)	S411P	probably damaging	Het
Carmil1	T	C	13: 24,228,215 (GRCm39)	E987G	probably damaging	Het
Dnah6	T	C	6: 73,021,711 (GRCm39)	D3537G	probably damaging	Het
Dnpep	A	T	1: 75,292,642 (GRCm39)	W126R	probably damaging	Het
Efcab2	T	C	1: 178,265,015 (GRCm39)	V27A	probably benign	Het
Kctd21	T	C	7: 96,996,548 (GRCm39)	L7P	probably damaging	Het
Lpl	T	A	8: 69,345,257 (GRCm39)	M87K	probably damaging	Het
Ltn1	A	G	16: 87,177,691 (GRCm39)	V1646A	probably benign	Het
Madcam1	A	G	10: 79,502,592 (GRCm39)	T359A	probably benign	Het
Muc5ac	A	G	7: 141,356,685 (GRCm39)	K1092E	possibly damaging	Het
Nrg2	T	C	18: 36,329,729 (GRCm39)	E162G	probably benign	Het
Or10ak11	A	T	4: 118,687,288 (GRCm39)	F117L	probably benign	Het
Or52e2	A	C	7: 102,804,613 (GRCm39)	S114A	probably damaging	Het
Or5p54	T	A	7: 107,554,174 (GRCm39)	S109T	probably benign	Het
Pcdhb5	G	T	18: 37,454,636 (GRCm39)	V339L	probably benign	Het
Plec	A	G	15: 76,076,484 (GRCm39)	W145R	unknown	Het
Polr3f	A	G	2: 144,378,230 (GRCm39)	N201D	probably benign	Het
Skint5	T	C	4: 113,662,139 (GRCm39)		probably null	Het
Slc12a2	A	G	18: 58,070,791 (GRCm39)	I1048V	probably benign	Het
Sult2a4	A	G	7: 13,723,401 (GRCm39)	I39T	probably benign	Het
Tenm4	T	C	7: 96,544,614 (GRCm39)	V2247A	probably damaging	Het
Tg	C	T	15: 66,645,247 (GRCm39)	R2385C	probably damaging	Het
Tomm70a	G	T	16: 56,942,330 (GRCm39)	A36S	unknown	Het
Top2b	G	A	14: 16,383,177 (GRCm38)	R55H	probably damaging	Het
Tut4	A	G	4: 108,369,347 (GRCm39)	I636V	probably benign	Het
Unc45b	A	G	11: 82,824,714 (GRCm39)	I629M	possibly damaging	Het
Vmn1r16	T	C	6: 57,300,424 (GRCm39)	E66G	noncoding transcript	Het
Vmn1r189	C	T	13: 22,286,301 (GRCm39)	V179I	probably benign	Het
Vmn2r105	T	G	17: 20,448,775 (GRCm39)	E134A	probably benign	Het
Wdr70	G	A	15: 7,916,851 (GRCm39)	A522V	probably benign	Het
Zfp184	T	A	13: 22,142,995 (GRCm39)	C234S	probably damaging	Het
Zscan5b	C	T	7: 6,236,946 (GRCm39)	P232S	possibly damaging	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25,088,559 (GRCm39)	splice site	probably benign
IGL00959:Kidins220	APN	12	25,101,132 (GRCm39)	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25,107,473 (GRCm39)	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25,060,925 (GRCm39)	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25,088,498 (GRCm39)	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25,090,459 (GRCm39)	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	25,044,999 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25,107,728 (GRCm39)	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25,054,110 (GRCm39)	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	25,047,332 (GRCm39)	splice site	probably benign
IGL02673:Kidins220	APN	12	25,044,991 (GRCm39)	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25,053,092 (GRCm39)	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25,053,044 (GRCm39)	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25,058,447 (GRCm39)	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	25,049,344 (GRCm39)	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25,058,155 (GRCm39)	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	25,049,351 (GRCm39)	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	25,049,351 (GRCm39)	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25,090,511 (GRCm39)	missense	probably damaging	0.98
R0280:Kidins220	UTSW	12	25,060,140 (GRCm39)	missense	probably damaging	1.00
R0334:Kidins220	UTSW	12	25,058,068 (GRCm39)	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25,055,087 (GRCm39)	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25,063,445 (GRCm39)	splice site	probably benign
R1808:Kidins220	UTSW	12	25,053,008 (GRCm39)	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25,106,590 (GRCm39)	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	25,044,905 (GRCm39)	missense	probably damaging	1.00
R1982:Kidins220	UTSW	12	25,101,193 (GRCm39)	missense	probably benign	0.01
R2069:Kidins220	UTSW	12	25,037,005 (GRCm39)	splice site	probably benign
R2101:Kidins220	UTSW	12	25,107,422 (GRCm39)	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25,091,302 (GRCm39)	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25,107,323 (GRCm39)	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25,061,508 (GRCm39)	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	25,040,757 (GRCm39)	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25,051,564 (GRCm39)	splice site	probably benign
R3915:Kidins220	UTSW	12	25,103,957 (GRCm39)	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25,107,143 (GRCm39)	splice site	probably null
R4287:Kidins220	UTSW	12	25,106,845 (GRCm39)	missense	possibly damaging	0.81
R4476:Kidins220	UTSW	12	25,061,000 (GRCm39)	missense	probably damaging	1.00
R4495:Kidins220	UTSW	12	25,088,301 (GRCm39)	splice site	probably null
R4627:Kidins220	UTSW	12	25,107,041 (GRCm39)	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25,107,284 (GRCm39)	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25,063,442 (GRCm39)	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	25,042,259 (GRCm39)	nonsense	probably null
R5118:Kidins220	UTSW	12	25,042,296 (GRCm39)	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25,101,125 (GRCm39)	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25,053,009 (GRCm39)	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25,097,896 (GRCm39)	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25,063,390 (GRCm39)	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25,107,139 (GRCm39)	nonsense	probably null
R6131:Kidins220	UTSW	12	25,042,313 (GRCm39)	splice site	probably null
R6146:Kidins220	UTSW	12	25,102,812 (GRCm39)	missense	probably damaging	1.00
R6151:Kidins220	UTSW	12	25,106,908 (GRCm39)	missense	possibly damaging	0.65
R6160:Kidins220	UTSW	12	25,047,310 (GRCm39)	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25,101,307 (GRCm39)	splice site	probably null
R6289:Kidins220	UTSW	12	25,106,615 (GRCm39)	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25,107,533 (GRCm39)	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25,107,190 (GRCm39)	missense	probably benign
R6513:Kidins220	UTSW	12	25,088,434 (GRCm39)	missense	possibly damaging	0.94
R6652:Kidins220	UTSW	12	25,060,059 (GRCm39)	splice site	probably null
R6711:Kidins220	UTSW	12	25,048,750 (GRCm39)	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25,058,542 (GRCm39)	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25,107,662 (GRCm39)	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25,054,018 (GRCm39)	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	25,044,820 (GRCm39)	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25,086,623 (GRCm39)	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25,061,570 (GRCm39)	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25,106,999 (GRCm39)	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	25,032,360 (GRCm39)	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	25,042,268 (GRCm39)	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	25,038,555 (GRCm39)	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	25,032,350 (GRCm39)	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25,111,230 (GRCm39)	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25,107,715 (GRCm39)	missense	probably benign	0.29
R8304:Kidins220	UTSW	12	25,107,127 (GRCm39)	missense	probably benign	0.01
R8313:Kidins220	UTSW	12	25,054,110 (GRCm39)	missense	probably damaging	1.00
R8346:Kidins220	UTSW	12	25,086,533 (GRCm39)	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	25,040,727 (GRCm39)	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25,090,527 (GRCm39)	missense	probably benign	0.00
R8722:Kidins220	UTSW	12	25,051,593 (GRCm39)	missense	probably benign
R8831:Kidins220	UTSW	12	25,086,454 (GRCm39)	missense	possibly damaging	0.70
R8960:Kidins220	UTSW	12	25,106,914 (GRCm39)	missense	probably benign	0.05
R9193:Kidins220	UTSW	12	25,036,966 (GRCm39)	missense	possibly damaging	0.79
R9267:Kidins220	UTSW	12	25,038,558 (GRCm39)	missense	probably benign	0.29
R9303:Kidins220	UTSW	12	25,107,110 (GRCm39)	missense	probably benign	0.36
R9343:Kidins220	UTSW	12	25,058,078 (GRCm39)	missense	probably damaging	1.00
R9526:Kidins220	UTSW	12	25,088,383 (GRCm39)	missense	probably damaging	1.00
R9644:Kidins220	UTSW	12	25,061,018 (GRCm39)	missense	probably damaging	1.00
R9655:Kidins220	UTSW	12	25,047,295 (GRCm39)	missense	probably damaging	1.00
R9664:Kidins220	UTSW	12	25,106,895 (GRCm39)	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- CACCACCAGCTGTTAAAATGTG -3'
(R):5'- ACAAATCTGAAGTAGGCCCC -3'

Sequencing Primer
(F):5'- AGTTACTCACAGGTGGTCTCCAG -3'
(R):5'- CTACCCTGTCAGGTATGTTCACG -3'

Posted On

2020-07-13