Incidental Mutation 'R8214:Zfp184'
ID636323
Institutional Source Beutler Lab
Gene Symbol Zfp184
Ensembl Gene ENSMUSG00000006720
Gene Namezinc finger protein 184 (Kruppel-like)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21945094-21960779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21958825 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 234 (C234S)
Ref Sequence ENSEMBL: ENSMUSP00000135173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006903] [ENSMUST00000102978] [ENSMUST00000176511] [ENSMUST00000176580]
Predicted Effect probably damaging
Transcript: ENSMUST00000006903
AA Change: C234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006903
Gene: ENSMUSG00000006720
AA Change: C234S

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102978
AA Change: C234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100043
Gene: ENSMUSG00000006720
AA Change: C234S

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176511
AA Change: C234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135173
Gene: ENSMUSG00000006720
AA Change: C234S

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176580
SMART Domains Protein: ENSMUSP00000135404
Gene: ENSMUSG00000006720

DomainStartEndE-ValueType
KRAB 28 84 1.96e-17 SMART
Meta Mutation Damage Score 0.8909 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a Kruppel C2H2-type zinc-finger protein family member. Sequence analysis predicts that the protein contains two Kruppel associated box (KRAB) boxes in the N-terminus and highly conserved zinc finger motifs at the C-terminus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Zfp184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp184 APN 13 21950225 splice site probably benign
R0393:Zfp184 UTSW 13 21947082 splice site probably benign
R0636:Zfp184 UTSW 13 21949749 missense probably damaging 1.00
R1657:Zfp184 UTSW 13 21959273 missense probably damaging 1.00
R1718:Zfp184 UTSW 13 21959272 missense possibly damaging 0.76
R4237:Zfp184 UTSW 13 21958778 missense probably damaging 1.00
R4326:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4327:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4328:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4877:Zfp184 UTSW 13 21960328 missense possibly damaging 0.92
R4941:Zfp184 UTSW 13 21949721 missense probably damaging 1.00
R5014:Zfp184 UTSW 13 21958424 missense probably benign 0.37
R5054:Zfp184 UTSW 13 21959282 missense possibly damaging 0.74
R5105:Zfp184 UTSW 13 21959629 missense possibly damaging 0.58
R5216:Zfp184 UTSW 13 21950236 missense probably damaging 1.00
R5379:Zfp184 UTSW 13 21959881 missense probably damaging 1.00
R5387:Zfp184 UTSW 13 21949640 intron probably benign
R5490:Zfp184 UTSW 13 21958577 missense probably benign 0.40
R6220:Zfp184 UTSW 13 21960207 missense probably damaging 1.00
R6752:Zfp184 UTSW 13 21959408 missense probably damaging 0.99
R7088:Zfp184 UTSW 13 21959992 missense probably damaging 1.00
R7653:Zfp184 UTSW 13 21959717 missense probably damaging 1.00
R7980:Zfp184 UTSW 13 21960206 missense probably damaging 1.00
R8056:Zfp184 UTSW 13 21958838 missense probably damaging 1.00
R8235:Zfp184 UTSW 13 21959883 missense probably damaging 1.00
R8748:Zfp184 UTSW 13 21960047 missense probably benign 0.00
R8891:Zfp184 UTSW 13 21959342 missense probably damaging 1.00
X0057:Zfp184 UTSW 13 21959548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCACTTGTGAGAGCAAC -3'
(R):5'- CCCACATTCATCACATTTATAGGGC -3'

Sequencing Primer
(F):5'- CACTTGTGAGAGCAACCTCAGTG -3'
(R):5'- ACATTTATAGGGCTTTTCTCCAGTG -3'
Posted On2020-07-13