Incidental Mutation 'R8214:Wdr70'
ID636328
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene NameWD repeat domain 70
Synonyms4833422F06Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location7873055-8099209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7887370 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 522 (A522V)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766]
Predicted Effect probably benign
Transcript: ENSMUST00000045766
AA Change: A522V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: A522V

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8019607 missense probably benign 0.07
IGL01121:Wdr70 APN 15 7873174 missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8079263 missense probably benign 0.33
IGL01801:Wdr70 APN 15 7887324 splice site probably null
IGL01815:Wdr70 APN 15 7887324 splice site probably null
IGL01929:Wdr70 APN 15 7920634 splice site probably null
IGL02150:Wdr70 APN 15 8082546 missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8046482 missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7884302 nonsense probably null
IGL02800:Wdr70 APN 15 8082496 missense probably benign 0.25
IGL02829:Wdr70 APN 15 7976982 missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7884306 missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7884340 missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8035871 missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0462:Wdr70 UTSW 15 8079161 missense probably benign 0.00
R0539:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8035844 missense probably benign 0.01
R1812:Wdr70 UTSW 15 8079179 missense probably benign 0.00
R1863:Wdr70 UTSW 15 7920573 missense probably benign 0.25
R1913:Wdr70 UTSW 15 7884410 missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7887359 nonsense probably null
R4013:Wdr70 UTSW 15 8079214 nonsense probably null
R4015:Wdr70 UTSW 15 8079214 nonsense probably null
R4017:Wdr70 UTSW 15 8079214 nonsense probably null
R4111:Wdr70 UTSW 15 7976991 missense probably benign 0.32
R5241:Wdr70 UTSW 15 8079216 missense probably benign
R5277:Wdr70 UTSW 15 7976984 nonsense probably null
R5306:Wdr70 UTSW 15 7924273 missense probably benign 0.04
R5426:Wdr70 UTSW 15 7922105 missense possibly damaging 0.59
R5586:Wdr70 UTSW 15 7884288 missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7887419 splice site probably null
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8079154 splice site probably null
R6139:Wdr70 UTSW 15 8079251 missense probably benign 0.04
R6400:Wdr70 UTSW 15 8042841 missense probably benign 0.32
R6456:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R6518:Wdr70 UTSW 15 8079337 missense unknown
R7036:Wdr70 UTSW 15 7884374 missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7884396 missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7924244 missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7922081 missense probably benign 0.23
R7572:Wdr70 UTSW 15 8035846 missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8079216 missense probably benign
R7886:Wdr70 UTSW 15 8079249 missense probably benign 0.02
R8103:Wdr70 UTSW 15 7977131 missense possibly damaging 0.70
R8252:Wdr70 UTSW 15 8042856 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGTACCTGTGTCCACATGAC -3'
(R):5'- GCCAAGATCTTCCAGTGTTTCC -3'

Sequencing Primer
(F):5'- CAGGACATAATGTAATAGATGCCAC -3'
(R):5'- CTGCTGGGGTCTACTACATACAG -3'
Posted On2020-07-13