Mutagenetix > Incidental Mutation

Incidental Mutation 'R8214:Ltn1'

636332

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8214 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87380803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1646 (V1646A)

Ref Sequence

ENSEMBL: ENSMUSP00000038775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449]

AlphaFold

Q6A009

Predicted Effect

probably benign
Transcript: ENSMUST00000039449
AA Change: V1646A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: V1646A

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,286,621	R52Q		Het
Abcc3	C	T	11: 94,363,518	R718H	probably damaging	Het
Abcc4	T	C	14: 118,500,841	M1166V	probably benign	Het
Abhd16b	C	T	2: 181,494,190	T295I	probably damaging	Het
Amph	A	G	13: 19,104,298	N319S	possibly damaging	Het
Ankrd27	A	G	7: 35,614,519	D425G	probably damaging	Het
Atg4b	T	C	1: 93,784,887	S316P	probably damaging	Het
Brd4	A	G	17: 32,212,947	S649P	probably benign	Het
Bzw1	T	C	1: 58,405,037	S411P	probably damaging	Het
Dnah6	T	C	6: 73,044,728	D3537G	probably damaging	Het
Dnpep	A	T	1: 75,315,998	W126R	probably damaging	Het
Efcab2	T	C	1: 178,437,450	V27A	probably benign	Het
Kctd21	T	C	7: 97,347,341	L7P	probably damaging	Het
Kidins220	C	T	12: 24,994,855	T216I	probably damaging	Het
Lpl	T	A	8: 68,892,605	M87K	probably damaging	Het
Lrrc16a	T	C	13: 24,044,232	E987G	probably damaging	Het
Madcam1	A	G	10: 79,666,758	T359A	probably benign	Het
Muc5ac	A	G	7: 141,802,948	K1092E	possibly damaging	Het
Nrg2	T	C	18: 36,196,676	E162G	probably benign	Het
Olfr1333	A	T	4: 118,830,091	F117L	probably benign	Het
Olfr474	T	A	7: 107,954,967	S109T	probably benign	Het
Olfr589	A	C	7: 103,155,406	S114A	probably damaging	Het
Pcdhb5	G	T	18: 37,321,583	V339L	probably benign	Het
Plec	A	G	15: 76,192,284	W145R	unknown	Het
Polr3f	A	G	2: 144,536,310	N201D	probably benign	Het
Skint5	T	C	4: 113,804,942		probably null	Het
Slc12a2	A	G	18: 57,937,719	I1048V	probably benign	Het
Sult2a4	A	G	7: 13,989,476	I39T	probably benign	Het
Tenm4	T	C	7: 96,895,407	V2247A	probably damaging	Het
Tg	C	T	15: 66,773,398	R2385C	probably damaging	Het
Tomm70a	G	T	16: 57,121,967	A36S	unknown	Het
Top2b	G	A	14: 16,383,177	R55H	probably damaging	Het
Unc45b	A	G	11: 82,933,888	I629M	possibly damaging	Het
Vmn1r16	T	C	6: 57,323,439	E66G	noncoding transcript	Het
Vmn1r189	C	T	13: 22,102,131	V179I	probably benign	Het
Vmn2r105	T	G	17: 20,228,513	E134A	probably benign	Het
Wdr70	G	A	15: 7,887,370	A522V	probably benign	Het
Zcchc11	A	G	4: 108,512,150	I636V	probably benign	Het
Zfp184	T	A	13: 21,958,825	C234S	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8889:Ltn1	UTSW	16	87432342	intron	probably benign
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
R9738:Ltn1	UTSW	16	87425636	missense	probably damaging	1.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGTGTGAGTGACCAGTGCG -3'
(R):5'- TGAATGCCTGGAATCAGATCAATG -3'

Sequencing Primer
(F):5'- GCTCGTGGCAGCATACCTG -3'
(R):5'- TGCCTGGAATCAGATCAATGATGAG -3'

Posted On

2020-07-13