Incidental Mutation 'R8214:Vmn2r105'
ID 636333
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Name vomeronasal 2, receptor 105
Synonyms EG627743
MMRRC Submission 067656-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8214 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20428492-20455134 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 20448775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 134 (E134A)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
AlphaFold E9Q3A5
Predicted Effect probably benign
Transcript: ENSMUST00000167382
AA Change: E134A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: E134A

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,177,447 (GRCm39) R52Q Het
Abcc3 C T 11: 94,254,344 (GRCm39) R718H probably damaging Het
Abcc4 T C 14: 118,738,253 (GRCm39) M1166V probably benign Het
Abhd16b C T 2: 181,135,983 (GRCm39) T295I probably damaging Het
Amph A G 13: 19,288,468 (GRCm39) N319S possibly damaging Het
Ankrd27 A G 7: 35,313,944 (GRCm39) D425G probably damaging Het
Atg4b T C 1: 93,712,609 (GRCm39) S316P probably damaging Het
Brd4 A G 17: 32,431,921 (GRCm39) S649P probably benign Het
Bzw1 T C 1: 58,444,196 (GRCm39) S411P probably damaging Het
Carmil1 T C 13: 24,228,215 (GRCm39) E987G probably damaging Het
Dnah6 T C 6: 73,021,711 (GRCm39) D3537G probably damaging Het
Dnpep A T 1: 75,292,642 (GRCm39) W126R probably damaging Het
Efcab2 T C 1: 178,265,015 (GRCm39) V27A probably benign Het
Kctd21 T C 7: 96,996,548 (GRCm39) L7P probably damaging Het
Kidins220 C T 12: 25,044,854 (GRCm39) T216I probably damaging Het
Lpl T A 8: 69,345,257 (GRCm39) M87K probably damaging Het
Ltn1 A G 16: 87,177,691 (GRCm39) V1646A probably benign Het
Madcam1 A G 10: 79,502,592 (GRCm39) T359A probably benign Het
Muc5ac A G 7: 141,356,685 (GRCm39) K1092E possibly damaging Het
Nrg2 T C 18: 36,329,729 (GRCm39) E162G probably benign Het
Or10ak11 A T 4: 118,687,288 (GRCm39) F117L probably benign Het
Or52e2 A C 7: 102,804,613 (GRCm39) S114A probably damaging Het
Or5p54 T A 7: 107,554,174 (GRCm39) S109T probably benign Het
Pcdhb5 G T 18: 37,454,636 (GRCm39) V339L probably benign Het
Plec A G 15: 76,076,484 (GRCm39) W145R unknown Het
Polr3f A G 2: 144,378,230 (GRCm39) N201D probably benign Het
Skint5 T C 4: 113,662,139 (GRCm39) probably null Het
Slc12a2 A G 18: 58,070,791 (GRCm39) I1048V probably benign Het
Sult2a4 A G 7: 13,723,401 (GRCm39) I39T probably benign Het
Tenm4 T C 7: 96,544,614 (GRCm39) V2247A probably damaging Het
Tg C T 15: 66,645,247 (GRCm39) R2385C probably damaging Het
Tomm70a G T 16: 56,942,330 (GRCm39) A36S unknown Het
Top2b G A 14: 16,383,177 (GRCm38) R55H probably damaging Het
Tut4 A G 4: 108,369,347 (GRCm39) I636V probably benign Het
Unc45b A G 11: 82,824,714 (GRCm39) I629M possibly damaging Het
Vmn1r16 T C 6: 57,300,424 (GRCm39) E66G noncoding transcript Het
Vmn1r189 C T 13: 22,286,301 (GRCm39) V179I probably benign Het
Wdr70 G A 15: 7,916,851 (GRCm39) A522V probably benign Het
Zfp184 T A 13: 22,142,995 (GRCm39) C234S probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20,448,817 (GRCm39) missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20,444,918 (GRCm39) missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20,428,973 (GRCm39) missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20,448,157 (GRCm39) missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20,429,345 (GRCm39) missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20,447,847 (GRCm39) missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20,446,631 (GRCm39) nonsense probably null
R0096:Vmn2r105 UTSW 17 20,447,741 (GRCm39) missense possibly damaging 0.49
R0096:Vmn2r105 UTSW 17 20,447,741 (GRCm39) missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20,428,827 (GRCm39) missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20,428,938 (GRCm39) missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20,454,965 (GRCm39) missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20,428,578 (GRCm39) missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20,448,119 (GRCm39) missense probably damaging 0.98
R0765:Vmn2r105 UTSW 17 20,447,973 (GRCm39) missense probably benign 0.20
R1162:Vmn2r105 UTSW 17 20,447,973 (GRCm39) missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20,428,584 (GRCm39) missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20,428,932 (GRCm39) missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20,449,004 (GRCm39) splice site probably benign
R2029:Vmn2r105 UTSW 17 20,444,840 (GRCm39) missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20,447,585 (GRCm39) missense probably damaging 1.00
R3847:Vmn2r105 UTSW 17 20,428,952 (GRCm39) missense possibly damaging 0.85
R3848:Vmn2r105 UTSW 17 20,428,952 (GRCm39) missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20,429,016 (GRCm39) missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20,448,902 (GRCm39) missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20,446,613 (GRCm39) missense probably benign
R4801:Vmn2r105 UTSW 17 20,447,556 (GRCm39) missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20,447,556 (GRCm39) missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20,428,953 (GRCm39) missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20,448,280 (GRCm39) missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20,428,676 (GRCm39) missense probably damaging 0.99
R5475:Vmn2r105 UTSW 17 20,455,044 (GRCm39) missense probably benign
R5576:Vmn2r105 UTSW 17 20,444,836 (GRCm39) critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20,448,998 (GRCm39) missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20,448,929 (GRCm39) missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20,428,889 (GRCm39) missense probably damaging 0.97
R6210:Vmn2r105 UTSW 17 20,448,758 (GRCm39) missense probably damaging 1.00
R6491:Vmn2r105 UTSW 17 20,447,992 (GRCm39) nonsense probably null
R6542:Vmn2r105 UTSW 17 20,448,803 (GRCm39) missense probably benign 0.03
R6729:Vmn2r105 UTSW 17 20,428,605 (GRCm39) missense probably damaging 0.99
R7020:Vmn2r105 UTSW 17 20,429,336 (GRCm39) missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20,428,874 (GRCm39) missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20,429,045 (GRCm39) missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20,448,827 (GRCm39) missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20,447,937 (GRCm39) missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20,428,937 (GRCm39) missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20,454,966 (GRCm39) missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20,428,904 (GRCm39) missense probably benign 0.07
R8186:Vmn2r105 UTSW 17 20,444,880 (GRCm39) nonsense probably null
R8497:Vmn2r105 UTSW 17 20,455,134 (GRCm39) start codon destroyed probably null 0.75
R8850:Vmn2r105 UTSW 17 20,428,872 (GRCm39) missense probably damaging 1.00
R8880:Vmn2r105 UTSW 17 20,429,229 (GRCm39) missense probably damaging 0.99
R9272:Vmn2r105 UTSW 17 20,447,685 (GRCm39) missense probably damaging 1.00
R9506:Vmn2r105 UTSW 17 20,429,404 (GRCm39) missense probably benign 0.00
R9549:Vmn2r105 UTSW 17 20,448,023 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AATGTGGATTGATCTCCTCGTG -3'
(R):5'- CCAATAACTTGTAGCAGCAGATCTG -3'

Sequencing Primer
(F):5'- ATTGATCTCCTCGTGTTTGAGTC -3'
(R):5'- GTCATGTGACATAAAGGCAATATTCC -3'
Posted On 2020-07-13