Mutagenetix > Incidental Mutation

Incidental Mutation 'R8214:Nrg2'

636335

Institutional Source

Beutler Lab

Gene Symbol

Nrg2

Ensembl Gene

ENSMUSG00000060275

Gene Name

neuregulin 2

Synonyms

NTAK, Don1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.256) question?

Stock #

R8214 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36017707-36197380 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36196676 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 162 (E162G)

Ref Sequence

ENSEMBL: ENSMUSP00000111378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115713]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115705

SMART Domains

Protein: ENSMUSP00000111370
Gene: ENSMUSG00000060275

Domain	Start	End	E-Value	Type
low complexity region	6	16	N/A	INTRINSIC
IGc2	105	175	3.85e-14	SMART
EGF	201	239	3.76e-1	SMART
low complexity region	265	274	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000111377
Gene: ENSMUSG00000060275
AA Change: E162G

Domain	Start	End	E-Value	Type
low complexity region	19	66	N/A	INTRINSIC
low complexity region	69	111	N/A	INTRINSIC
IGc2	259	329	3.85e-14	SMART
EGF	355	393	1.66e-2	SMART
Pfam:Neuregulin	403	834	1.7e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115713
AA Change: E162G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000111378
Gene: ENSMUSG00000060275
AA Change: E162G

Domain	Start	End	E-Value	Type
low complexity region	19	66	N/A	INTRINSIC
low complexity region	69	111	N/A	INTRINSIC
IGc2	259	329	3.85e-14	SMART
EGF	355	393	3.76e-1	SMART
Pfam:Neuregulin	409	844	4.4e-170	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: About one third of mice homozygous for a knock-out allele die prior to weaning in the absence of cardiac defects or other morphological abnormalities. Homozygotes display an early but transient postnatal growth deficit and reduced reproductive capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,286,621	R52Q		Het
Abcc3	C	T	11: 94,363,518	R718H	probably damaging	Het
Abcc4	T	C	14: 118,500,841	M1166V	probably benign	Het
Abhd16b	C	T	2: 181,494,190	T295I	probably damaging	Het
Amph	A	G	13: 19,104,298	N319S	possibly damaging	Het
Ankrd27	A	G	7: 35,614,519	D425G	probably damaging	Het
Atg4b	T	C	1: 93,784,887	S316P	probably damaging	Het
Brd4	A	G	17: 32,212,947	S649P	probably benign	Het
Bzw1	T	C	1: 58,405,037	S411P	probably damaging	Het
Carmil1	T	C	13: 24,044,232	E987G	probably damaging	Het
Dnah6	T	C	6: 73,044,728	D3537G	probably damaging	Het
Dnpep	A	T	1: 75,315,998	W126R	probably damaging	Het
Efcab2	T	C	1: 178,437,450	V27A	probably benign	Het
Kctd21	T	C	7: 97,347,341	L7P	probably damaging	Het
Kidins220	C	T	12: 24,994,855	T216I	probably damaging	Het
Lpl	T	A	8: 68,892,605	M87K	probably damaging	Het
Ltn1	A	G	16: 87,380,803	V1646A	probably benign	Het
Madcam1	A	G	10: 79,666,758	T359A	probably benign	Het
Muc5ac	A	G	7: 141,802,948	K1092E	possibly damaging	Het
Olfr1333	A	T	4: 118,830,091	F117L	probably benign	Het
Olfr474	T	A	7: 107,954,967	S109T	probably benign	Het
Olfr589	A	C	7: 103,155,406	S114A	probably damaging	Het
Pcdhb5	G	T	18: 37,321,583	V339L	probably benign	Het
Plec	A	G	15: 76,192,284	W145R	unknown	Het
Polr3f	A	G	2: 144,536,310	N201D	probably benign	Het
Skint5	T	C	4: 113,804,942		probably null	Het
Slc12a2	A	G	18: 57,937,719	I1048V	probably benign	Het
Sult2a4	A	G	7: 13,989,476	I39T	probably benign	Het
Tenm4	T	C	7: 96,895,407	V2247A	probably damaging	Het
Tg	C	T	15: 66,773,398	R2385C	probably damaging	Het
Tomm70a	G	T	16: 57,121,967	A36S	unknown	Het
Top2b	G	A	14: 16,383,177	R55H	probably damaging	Het
Unc45b	A	G	11: 82,933,888	I629M	possibly damaging	Het
Vmn1r16	T	C	6: 57,323,439	E66G	noncoding transcript	Het
Vmn1r189	C	T	13: 22,102,131	V179I	probably benign	Het
Vmn2r105	T	G	17: 20,228,513	E134A	probably benign	Het
Wdr70	G	A	15: 7,887,370	A522V	probably benign	Het
Zcchc11	A	G	4: 108,512,150	I636V	probably benign	Het
Zfp184	T	A	13: 21,958,825	C234S	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Nrg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Nrg2	APN	18	36021218	missense	probably benign	0.00
IGL01396:Nrg2	APN	18	36045852	splice site	probably benign
R0179:Nrg2	UTSW	18	36022415	missense	probably benign	0.13
R0976:Nrg2	UTSW	18	36021091	missense	probably benign	0.21
R1387:Nrg2	UTSW	18	36196739	missense	probably damaging	1.00
R1487:Nrg2	UTSW	18	36052912	missense	possibly damaging	0.69
R1746:Nrg2	UTSW	18	36021922	missense	probably damaging	1.00
R1882:Nrg2	UTSW	18	36021097	missense	probably damaging	1.00
R1940:Nrg2	UTSW	18	36196844	unclassified	probably benign
R2090:Nrg2	UTSW	18	36018443	missense	probably benign	0.00
R2183:Nrg2	UTSW	18	36196751	missense	probably benign	0.11
R4664:Nrg2	UTSW	18	36052895	missense	possibly damaging	0.87
R4677:Nrg2	UTSW	18	36021099	missense	possibly damaging	0.92
R4860:Nrg2	UTSW	18	36196547	missense	probably damaging	1.00
R4860:Nrg2	UTSW	18	36196547	missense	probably damaging	1.00
R5091:Nrg2	UTSW	18	36052785	missense	probably damaging	1.00
R6657:Nrg2	UTSW	18	36196589	missense	probably damaging	0.98
R6968:Nrg2	UTSW	18	36196446	missense	probably benign	0.01
R7186:Nrg2	UTSW	18	36045920	missense	probably benign	0.17
R7304:Nrg2	UTSW	18	36045941	missense	probably benign	0.24
R7467:Nrg2	UTSW	18	36022406	missense	probably benign	0.00
R7564:Nrg2	UTSW	18	36024396	missense	probably damaging	1.00
R7876:Nrg2	UTSW	18	36197087	missense	unknown
R8113:Nrg2	UTSW	18	36021103	missense	probably damaging	1.00
R8133:Nrg2	UTSW	18	36032377	missense	probably benign	0.00
R8261:Nrg2	UTSW	18	36032375	missense	probably benign	0.11
R9000:Nrg2	UTSW	18	36018629	missense	probably damaging	1.00
R9131:Nrg2	UTSW	18	36024343	missense	probably damaging	1.00
R9484:Nrg2	UTSW	18	36024348	missense	probably null
R9512:Nrg2	UTSW	18	36045957	missense	probably benign	0.11
R9667:Nrg2	UTSW	18	36032377	missense	probably benign	0.09
Z1176:Nrg2	UTSW	18	36018470	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AAACTAAGGGCTGCTCGGTG -3'
(R):5'- GCTACAGCTACAGTTACAGCG -3'

Sequencing Primer
(F):5'- TCGGTGGGCTCCAGGAAAAAG -3'
(R):5'- AGCAGCAGCATCTTCCGTC -3'

Posted On

2020-07-13