Mutagenetix > Incidental Mutation

Incidental Mutation 'R8214:Slc12a2'

636337

Institutional Source

Beutler Lab

Gene Symbol

Slc12a2

Ensembl Gene

ENSMUSG00000024597

Gene Name

solute carrier family 12, member 2

Synonyms

Nkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8214 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57878678-57946821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57937719 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1048 (I1048V)

Ref Sequence

ENSEMBL: ENSMUSP00000111023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115366]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000115366
AA Change: I1048V

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: I1048V

Domain	Start	End	E-Value	Type
low complexity region	3	33	N/A	INTRINSIC
low complexity region	43	59	N/A	INTRINSIC
SCOP:d1gkub1	91	122	4e-3	SMART
low complexity region	141	162	N/A	INTRINSIC
low complexity region	175	190	N/A	INTRINSIC
Pfam:AA_permease_N	196	260	5.9e-29	PFAM
Pfam:AA_permease	284	787	4.1e-154	PFAM
Pfam:AA_permease_2	290	743	8.7e-22	PFAM
Pfam:SLC12	795	1206	2.7e-167	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,286,621	R52Q		Het
Abcc3	C	T	11: 94,363,518	R718H	probably damaging	Het
Abcc4	T	C	14: 118,500,841	M1166V	probably benign	Het
Abhd16b	C	T	2: 181,494,190	T295I	probably damaging	Het
Amph	A	G	13: 19,104,298	N319S	possibly damaging	Het
Ankrd27	A	G	7: 35,614,519	D425G	probably damaging	Het
Atg4b	T	C	1: 93,784,887	S316P	probably damaging	Het
Brd4	A	G	17: 32,212,947	S649P	probably benign	Het
Bzw1	T	C	1: 58,405,037	S411P	probably damaging	Het
Carmil1	T	C	13: 24,044,232	E987G	probably damaging	Het
Dnah6	T	C	6: 73,044,728	D3537G	probably damaging	Het
Dnpep	A	T	1: 75,315,998	W126R	probably damaging	Het
Efcab2	T	C	1: 178,437,450	V27A	probably benign	Het
Kctd21	T	C	7: 97,347,341	L7P	probably damaging	Het
Kidins220	C	T	12: 24,994,855	T216I	probably damaging	Het
Lpl	T	A	8: 68,892,605	M87K	probably damaging	Het
Ltn1	A	G	16: 87,380,803	V1646A	probably benign	Het
Madcam1	A	G	10: 79,666,758	T359A	probably benign	Het
Muc5ac	A	G	7: 141,802,948	K1092E	possibly damaging	Het
Nrg2	T	C	18: 36,196,676	E162G	probably benign	Het
Olfr1333	A	T	4: 118,830,091	F117L	probably benign	Het
Olfr474	T	A	7: 107,954,967	S109T	probably benign	Het
Olfr589	A	C	7: 103,155,406	S114A	probably damaging	Het
Pcdhb5	G	T	18: 37,321,583	V339L	probably benign	Het
Plec	A	G	15: 76,192,284	W145R	unknown	Het
Polr3f	A	G	2: 144,536,310	N201D	probably benign	Het
Skint5	T	C	4: 113,804,942		probably null	Het
Sult2a4	A	G	7: 13,989,476	I39T	probably benign	Het
Tenm4	T	C	7: 96,895,407	V2247A	probably damaging	Het
Tg	C	T	15: 66,773,398	R2385C	probably damaging	Het
Tomm70a	G	T	16: 57,121,967	A36S	unknown	Het
Top2b	G	A	14: 16,383,177	R55H	probably damaging	Het
Unc45b	A	G	11: 82,933,888	I629M	possibly damaging	Het
Vmn1r16	T	C	6: 57,323,439	E66G	noncoding transcript	Het
Vmn1r189	C	T	13: 22,102,131	V179I	probably benign	Het
Vmn2r105	T	G	17: 20,228,513	E134A	probably benign	Het
Wdr70	G	A	15: 7,887,370	A522V	probably benign	Het
Zcchc11	A	G	4: 108,512,150	I636V	probably benign	Het
Zfp184	T	A	13: 21,958,825	C234S	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Slc12a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00491:Slc12a2	APN	18	57936405	missense	probably damaging	1.00
IGL01099:Slc12a2	APN	18	57906020	nonsense	probably null
IGL01896:Slc12a2	APN	18	57896308	missense	probably benign	0.06
IGL02266:Slc12a2	APN	18	57912020	splice site	probably benign
IGL02489:Slc12a2	APN	18	57912002	missense	probably damaging	0.98
IGL02681:Slc12a2	APN	18	57879399	missense	probably benign	0.25
IGL03068:Slc12a2	APN	18	57904335	splice site	probably benign
IGL03076:Slc12a2	APN	18	57926397	splice site	probably benign
IGL03086:Slc12a2	APN	18	57921784	missense	probably benign	0.00
IGL03238:Slc12a2	APN	18	57914234	missense	possibly damaging	0.85
frankie	UTSW	18	57934963	missense	possibly damaging	0.48
honeylamb	UTSW	18	57930166	missense	probably damaging	1.00
sugar	UTSW	18	57899272	missense	probably damaging	1.00
R0048:Slc12a2	UTSW	18	57915522	splice site	probably benign
R0194:Slc12a2	UTSW	18	57930211	missense	probably damaging	1.00
R0530:Slc12a2	UTSW	18	57919536	missense	possibly damaging	0.76
R0959:Slc12a2	UTSW	18	57904378	missense	probably damaging	1.00
R1014:Slc12a2	UTSW	18	57921810	missense	probably benign	0.00
R1112:Slc12a2	UTSW	18	57937752	missense	probably benign	0.01
R1544:Slc12a2	UTSW	18	57879302	missense	probably benign	0.00
R1669:Slc12a2	UTSW	18	57904235	missense	probably damaging	0.99
R1935:Slc12a2	UTSW	18	57904353	missense	possibly damaging	0.95
R1951:Slc12a2	UTSW	18	57879395	missense	possibly damaging	0.51
R1990:Slc12a2	UTSW	18	57910286	missense	possibly damaging	0.61
R2340:Slc12a2	UTSW	18	57900050	missense	probably benign	0.03
R3971:Slc12a2	UTSW	18	57930196	missense	possibly damaging	0.84
R4120:Slc12a2	UTSW	18	57899355	missense	possibly damaging	0.95
R4223:Slc12a2	UTSW	18	57910256	missense	probably damaging	1.00
R4541:Slc12a2	UTSW	18	57912965	splice site	probably null
R4678:Slc12a2	UTSW	18	57905960	nonsense	probably null
R4931:Slc12a2	UTSW	18	57934963	missense	possibly damaging	0.48
R5114:Slc12a2	UTSW	18	57899272	missense	probably damaging	1.00
R5226:Slc12a2	UTSW	18	57879020	missense	probably damaging	1.00
R5648:Slc12a2	UTSW	18	57896310	missense	possibly damaging	0.83
R5726:Slc12a2	UTSW	18	57896354	missense	probably benign	0.01
R5789:Slc12a2	UTSW	18	57912019	splice site	probably null
R5868:Slc12a2	UTSW	18	57943996	missense	probably damaging	1.00
R5921:Slc12a2	UTSW	18	57932523	missense	probably benign	0.06
R6126:Slc12a2	UTSW	18	57944044	missense	possibly damaging	0.94
R6310:Slc12a2	UTSW	18	57915506	missense	probably damaging	0.99
R6598:Slc12a2	UTSW	18	57898073	missense	probably benign	0.01
R6615:Slc12a2	UTSW	18	57898128	missense	probably damaging	1.00
R6911:Slc12a2	UTSW	18	57919469	missense	probably benign	0.05
R6957:Slc12a2	UTSW	18	57910272	nonsense	probably null
R7411:Slc12a2	UTSW	18	57941013	missense	probably benign	0.01
R7508:Slc12a2	UTSW	18	57904393	missense	probably benign	0.01
R7645:Slc12a2	UTSW	18	57896378	missense	possibly damaging	0.94
R7658:Slc12a2	UTSW	18	57932524	missense	probably benign	0.02
R8054:Slc12a2	UTSW	18	57921872	nonsense	probably null
R8093:Slc12a2	UTSW	18	57879351	missense	probably benign	0.17
R8099:Slc12a2	UTSW	18	57899392	missense	probably damaging	0.99
R8121:Slc12a2	UTSW	18	57899331	missense	probably benign	0.44
R8273:Slc12a2	UTSW	18	57914266	splice site	probably benign
R8341:Slc12a2	UTSW	18	57879209	missense	possibly damaging	0.48
R8485:Slc12a2	UTSW	18	57941146	critical splice donor site	probably null
R8797:Slc12a2	UTSW	18	57879383	missense	possibly damaging	0.80
R9049:Slc12a2	UTSW	18	57921791	nonsense	probably null
R9180:Slc12a2	UTSW	18	57936397	missense	possibly damaging	0.83
R9256:Slc12a2	UTSW	18	57941795	missense	probably damaging	1.00
R9337:Slc12a2	UTSW	18	57930166	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCCTCTGTGACAGACTTG -3'
(R):5'- CTAACATCTGACAGAGCAGGTAGTAG -3'

Sequencing Primer
(F):5'- ACAGACTTGTCAAGGGAAGAC -3'
(R):5'- GAGCAGGTAGTAGTAAAAAGACTTTC -3'

Posted On

2020-07-13