Incidental Mutation 'R8214:Slc12a2'
ID636337
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Namesolute carrier family 12, member 2
SynonymsNkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location57878678-57946821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57937719 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1048 (I1048V)
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
Predicted Effect probably benign
Transcript: ENSMUST00000115366
AA Change: I1048V

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: I1048V

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 57936405 missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 57906020 nonsense probably null
IGL01896:Slc12a2 APN 18 57896308 missense probably benign 0.06
IGL02266:Slc12a2 APN 18 57912020 splice site probably benign
IGL02489:Slc12a2 APN 18 57912002 missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 57879399 missense probably benign 0.25
IGL03068:Slc12a2 APN 18 57904335 splice site probably benign
IGL03076:Slc12a2 APN 18 57926397 splice site probably benign
IGL03086:Slc12a2 APN 18 57921784 missense probably benign 0.00
IGL03238:Slc12a2 APN 18 57914234 missense possibly damaging 0.85
frankie UTSW 18 57934963 missense possibly damaging 0.48
sugar UTSW 18 57899272 missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 57915522 splice site probably benign
R0194:Slc12a2 UTSW 18 57930211 missense probably damaging 1.00
R0530:Slc12a2 UTSW 18 57919536 missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 57904378 missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 57921810 missense probably benign 0.00
R1112:Slc12a2 UTSW 18 57937752 missense probably benign 0.01
R1544:Slc12a2 UTSW 18 57879302 missense probably benign 0.00
R1669:Slc12a2 UTSW 18 57904235 missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 57904353 missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 57879395 missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 57910286 missense possibly damaging 0.61
R2340:Slc12a2 UTSW 18 57900050 missense probably benign 0.03
R3971:Slc12a2 UTSW 18 57930196 missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 57899355 missense possibly damaging 0.95
R4223:Slc12a2 UTSW 18 57910256 missense probably damaging 1.00
R4541:Slc12a2 UTSW 18 57912965 splice site probably null
R4678:Slc12a2 UTSW 18 57905960 nonsense probably null
R4931:Slc12a2 UTSW 18 57934963 missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 57899272 missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 57879020 missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 57896310 missense possibly damaging 0.83
R5726:Slc12a2 UTSW 18 57896354 missense probably benign 0.01
R5789:Slc12a2 UTSW 18 57912019 splice site probably null
R5868:Slc12a2 UTSW 18 57943996 missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 57932523 missense probably benign 0.06
R6126:Slc12a2 UTSW 18 57944044 missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 57915506 missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 57898073 missense probably benign 0.01
R6615:Slc12a2 UTSW 18 57898128 missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 57919469 missense probably benign 0.05
R6957:Slc12a2 UTSW 18 57910272 nonsense probably null
R7411:Slc12a2 UTSW 18 57941013 missense probably benign 0.01
R7508:Slc12a2 UTSW 18 57904393 missense probably benign 0.01
R7645:Slc12a2 UTSW 18 57896378 missense possibly damaging 0.94
R7658:Slc12a2 UTSW 18 57932524 missense probably benign 0.02
R8054:Slc12a2 UTSW 18 57921872 nonsense probably null
R8093:Slc12a2 UTSW 18 57879351 missense probably benign 0.17
R8099:Slc12a2 UTSW 18 57899392 missense probably damaging 0.99
R8121:Slc12a2 UTSW 18 57899331 missense probably benign 0.44
R8273:Slc12a2 UTSW 18 57914266 splice site probably benign
R8341:Slc12a2 UTSW 18 57879209 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTCCCTCTGTGACAGACTTG -3'
(R):5'- CTAACATCTGACAGAGCAGGTAGTAG -3'

Sequencing Primer
(F):5'- ACAGACTTGTCAAGGGAAGAC -3'
(R):5'- GAGCAGGTAGTAGTAAAAAGACTTTC -3'
Posted On2020-07-13