Incidental Mutation 'R8215:Olfr470'
ID636367
Institutional Source Beutler Lab
Gene Symbol Olfr470
Ensembl Gene ENSMUSG00000109542
Gene Nameolfactory receptor 470
SynonymsMOR204-22, GA_x6K02T2PBJ9-10175273-10174329
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R8215 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107842905-107847490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107844917 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 272 (D272A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000220193]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073059
AA Change: D272A

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: D272A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084757
AA Change: D272A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081812
Gene: ENSMUSG00000094289
AA Change: D272A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-51 PFAM
Pfam:7tm_1 44 293 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219309
Predicted Effect possibly damaging
Transcript: ENSMUST00000220193
AA Change: D272A

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,065,100 R1066L probably benign Het
Abca14 A C 7: 120,294,202 I1292L probably benign Het
Adamtsl1 T G 4: 86,343,145 F1206V probably benign Het
Agl T C 3: 116,788,644 H243R probably damaging Het
Btn2a2 A C 13: 23,481,870 L264R probably damaging Het
Ccdc108 A G 1: 74,910,743 L1201P probably damaging Het
Ccdc33 A T 9: 58,032,712 S749T probably benign Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Chsy3 C T 18: 59,175,869 Q65* probably null Het
Clic5 T A 17: 44,275,341 L239* probably null Het
Corin T C 5: 72,305,018 D957G probably damaging Het
Cped1 A T 6: 22,132,278 Y486F probably damaging Het
Csnk1g3 C T 18: 53,948,079 T374M probably benign Het
D930020B18Rik T A 10: 121,667,524 C201* probably null Het
Dnah2 A G 11: 69,435,367 F3653L probably damaging Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Foxj3 T G 4: 119,621,611 S455R unknown Het
Gcnt3 T C 9: 70,034,173 D371G probably damaging Het
Gm10837 A G 14: 122,490,781 E23G unknown Het
Gm38394 G T 1: 133,658,792 A269E probably damaging Het
Gm5346 T A 8: 43,626,501 T229S probably benign Het
Hivep3 T C 4: 120,122,901 V1712A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A G 6: 52,163,061 V315A probably damaging Het
Irx5 A T 8: 92,359,613 Y108F possibly damaging Het
Itsn1 T C 16: 91,812,108 I248T probably damaging Het
Kcnb1 T C 2: 167,104,441 K829R probably benign Het
Klhl17 A G 4: 156,230,053 V635A unknown Het
Krr1 C T 10: 111,979,929 R234* probably null Het
Lrrc7 A T 3: 158,209,750 D209E probably benign Het
Mcm2 T C 6: 88,897,311 E71G probably damaging Het
Mroh5 C A 15: 73,819,290 K10N probably damaging Het
Myh3 A G 11: 67,101,179 E1850G probably damaging Het
Nedd9 T C 13: 41,338,843 I64V probably benign Het
Nisch A G 14: 31,186,701 S456P possibly damaging Het
Nrcam T C 12: 44,564,113 V532A probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr639 T C 7: 104,012,123 D193G possibly damaging Het
Olfr851 T C 9: 19,497,500 F251L probably damaging Het
Plekhg1 C T 10: 3,957,521 P868S Het
Ptf1a A G 2: 19,445,949 Q30R possibly damaging Het
Ptgs1 G T 2: 36,251,167 C542F probably damaging Het
Rere T A 4: 150,616,967 M1268K possibly damaging Het
Rp1 A G 1: 4,245,095 F485L unknown Het
Samd14 A T 11: 95,014,387 E8D probably benign Het
Serpinh1 A G 7: 99,346,338 Y346H possibly damaging Het
Shq1 A T 6: 100,671,060 M1K probably null Het
Tfrc T C 16: 32,625,030 S551P probably damaging Het
Tnr A C 1: 159,888,290 N874T possibly damaging Het
Trak1 C A 9: 121,469,030 T667N probably damaging Het
Trpv2 A C 11: 62,590,931 T423P probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r24 A G 6: 123,779,118 T50A probably benign Het
Xirp2 T A 2: 67,516,509 D3031E probably benign Het
Zbtb4 A C 11: 69,778,772 I774L probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfp651 T C 9: 121,767,278 S604P probably benign Het
Other mutations in Olfr470
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr470 APN 7 107845178 missense probably benign 0.00
IGL02349:Olfr470 APN 7 107845605 missense probably benign 0.03
IGL02365:Olfr470 APN 7 107844912 missense probably damaging 1.00
R0070:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R0540:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0607:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0624:Olfr470 UTSW 7 107845116 missense possibly damaging 0.87
R1983:Olfr470 UTSW 7 107845412 missense probably benign 0.36
R2420:Olfr470 UTSW 7 107844818 missense probably benign 0.03
R2441:Olfr470 UTSW 7 107844978 missense probably benign 0.10
R4395:Olfr470 UTSW 7 107845262 missense probably damaging 1.00
R4734:Olfr470 UTSW 7 107845428 missense probably benign 0.00
R4779:Olfr470 UTSW 7 107845548 missense possibly damaging 0.96
R5874:Olfr470 UTSW 7 107845170 missense probably benign
R6598:Olfr470 UTSW 7 107845263 missense probably benign 0.06
R6807:Olfr470 UTSW 7 107845590 missense possibly damaging 0.67
R6820:Olfr470 UTSW 7 107845091 missense probably benign 0.01
R7305:Olfr470 UTSW 7 107845365 missense probably damaging 1.00
R7413:Olfr470 UTSW 7 107845514 missense probably damaging 1.00
R7954:Olfr470 UTSW 7 107844912 missense probably benign 0.01
R8255:Olfr470 UTSW 7 107845161 missense probably damaging 1.00
R8384:Olfr470 UTSW 7 107845258 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAGAACATATATTTCAGCCACAGG -3'
(R):5'- ACAGTGTCTGTCATAGCCATCTC -3'

Sequencing Primer
(F):5'- GTGTCTGTCTGTAGGATGTTATTAC -3'
(R):5'- GTGTCTGTCATAGCCATCTCCTACAC -3'
Posted On2020-07-13