Incidental Mutation 'R8215:Irx5'
ID636370
Institutional Source Beutler Lab
Gene Symbol Irx5
Ensembl Gene ENSMUSG00000031737
Gene NameIroquois homeobox 5
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8215 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location92357625-92376286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92359613 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 108 (Y108F)
Ref Sequence ENSEMBL: ENSMUSP00000034184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034184] [ENSMUST00000210246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034184
AA Change: Y108F

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034184
Gene: ENSMUSG00000031737
AA Change: Y108F

DomainStartEndE-ValueType
HOX 112 177 1.14e-12 SMART
low complexity region 185 202 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
IRO 328 345 2.28e-5 SMART
low complexity region 351 369 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 417 439 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210246
AA Change: Y108F

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, narrow eye opening, and impaired retinal cone bipolar cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,065,100 R1066L probably benign Het
Abca14 A C 7: 120,294,202 I1292L probably benign Het
Adamtsl1 T G 4: 86,343,145 F1206V probably benign Het
Agl T C 3: 116,788,644 H243R probably damaging Het
Btn2a2 A C 13: 23,481,870 L264R probably damaging Het
Ccdc108 A G 1: 74,910,743 L1201P probably damaging Het
Ccdc33 A T 9: 58,032,712 S749T probably benign Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Chsy3 C T 18: 59,175,869 Q65* probably null Het
Clic5 T A 17: 44,275,341 L239* probably null Het
Corin T C 5: 72,305,018 D957G probably damaging Het
Cped1 A T 6: 22,132,278 Y486F probably damaging Het
Csnk1g3 C T 18: 53,948,079 T374M probably benign Het
D930020B18Rik T A 10: 121,667,524 C201* probably null Het
Dnah2 A G 11: 69,435,367 F3653L probably damaging Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Foxj3 T G 4: 119,621,611 S455R unknown Het
Gcnt3 T C 9: 70,034,173 D371G probably damaging Het
Gm10837 A G 14: 122,490,781 E23G unknown Het
Gm38394 G T 1: 133,658,792 A269E probably damaging Het
Gm5346 T A 8: 43,626,501 T229S probably benign Het
Hivep3 T C 4: 120,122,901 V1712A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A G 6: 52,163,061 V315A probably damaging Het
Itsn1 T C 16: 91,812,108 I248T probably damaging Het
Kcnb1 T C 2: 167,104,441 K829R probably benign Het
Klhl17 A G 4: 156,230,053 V635A unknown Het
Krr1 C T 10: 111,979,929 R234* probably null Het
Lrrc7 A T 3: 158,209,750 D209E probably benign Het
Mcm2 T C 6: 88,897,311 E71G probably damaging Het
Mroh5 C A 15: 73,819,290 K10N probably damaging Het
Myh3 A G 11: 67,101,179 E1850G probably damaging Het
Nedd9 T C 13: 41,338,843 I64V probably benign Het
Nisch A G 14: 31,186,701 S456P possibly damaging Het
Nrcam T C 12: 44,564,113 V532A probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr470 T G 7: 107,844,917 D272A probably damaging Het
Olfr639 T C 7: 104,012,123 D193G possibly damaging Het
Olfr851 T C 9: 19,497,500 F251L probably damaging Het
Plekhg1 C T 10: 3,957,521 P868S Het
Ptf1a A G 2: 19,445,949 Q30R possibly damaging Het
Ptgs1 G T 2: 36,251,167 C542F probably damaging Het
Rere T A 4: 150,616,967 M1268K possibly damaging Het
Rp1 A G 1: 4,245,095 F485L unknown Het
Samd14 A T 11: 95,014,387 E8D probably benign Het
Serpinh1 A G 7: 99,346,338 Y346H possibly damaging Het
Shq1 A T 6: 100,671,060 M1K probably null Het
Tfrc T C 16: 32,625,030 S551P probably damaging Het
Tnr A C 1: 159,888,290 N874T possibly damaging Het
Trak1 C A 9: 121,469,030 T667N probably damaging Het
Trpv2 A C 11: 62,590,931 T423P probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r24 A G 6: 123,779,118 T50A probably benign Het
Xirp2 T A 2: 67,516,509 D3031E probably benign Het
Zbtb4 A C 11: 69,778,772 I774L probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfp651 T C 9: 121,767,278 S604P probably benign Het
Other mutations in Irx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Irx5 APN 8 92360703 missense probably damaging 1.00
IGL01870:Irx5 APN 8 92359777 missense probably damaging 1.00
IGL01985:Irx5 APN 8 92359527 splice site probably benign
IGL02481:Irx5 APN 8 92360679 missense probably damaging 1.00
IGL02597:Irx5 APN 8 92360772 missense possibly damaging 0.93
IGL03257:Irx5 APN 8 92360630 missense probably benign 0.00
R0784:Irx5 UTSW 8 92360490 missense probably benign
R1498:Irx5 UTSW 8 92359886 missense probably damaging 1.00
R1762:Irx5 UTSW 8 92359644 missense probably damaging 1.00
R1783:Irx5 UTSW 8 92359688 missense probably damaging 1.00
R1951:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R1953:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R2019:Irx5 UTSW 8 92358364 missense probably damaging 1.00
R3875:Irx5 UTSW 8 92360165 missense probably benign 0.00
R3942:Irx5 UTSW 8 92359686 missense probably damaging 0.98
R4361:Irx5 UTSW 8 92358397 missense probably damaging 0.99
R4574:Irx5 UTSW 8 92358262 missense probably damaging 0.99
R4994:Irx5 UTSW 8 92360781 missense probably damaging 1.00
R5579:Irx5 UTSW 8 92359913 missense probably benign 0.01
R5884:Irx5 UTSW 8 92360630 missense possibly damaging 0.95
R5988:Irx5 UTSW 8 92360671 nonsense probably null
R6017:Irx5 UTSW 8 92358250 missense probably damaging 1.00
R6339:Irx5 UTSW 8 92359853 missense probably damaging 0.99
R6466:Irx5 UTSW 8 92359726 missense probably damaging 1.00
R6595:Irx5 UTSW 8 92359619 missense probably damaging 1.00
R7344:Irx5 UTSW 8 92359555 missense probably benign 0.24
R8166:Irx5 UTSW 8 92360084 splice site probably null
R8396:Irx5 UTSW 8 92360334 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCTGGCACTCAAAACCAAGG -3'
(R):5'- ATCCACCAACCTGATTCGGG -3'

Sequencing Primer
(F):5'- CACTCAAAACCAAGGACAGAGGG -3'
(R):5'- GGCGTCCACGTCATCTTG -3'
Posted On2020-07-13