Incidental Mutation 'R8215:Ccdc33'
ID 636374
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
MMRRC Submission 067657-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8215 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 57935960-58026106 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57939995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 749 (S749T)
Ref Sequence ENSEMBL: ENSMUSP00000096279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042205
AA Change: S564T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: S564T

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
AA Change: S749T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: S749T

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119665
AA Change: S563T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: S563T

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.8%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 81,949,301 (GRCm39) R1066L probably benign Het
Abca14 A C 7: 119,893,425 (GRCm39) I1292L probably benign Het
Adam34l T A 8: 44,079,538 (GRCm39) T229S probably benign Het
Adamtsl1 T G 4: 86,261,382 (GRCm39) F1206V probably benign Het
Agl T C 3: 116,582,293 (GRCm39) H243R probably damaging Het
Btn2a2 A C 13: 23,666,040 (GRCm39) L264R probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,347,337 (GRCm39) probably null Het
Cdh8 A G 8: 99,757,498 (GRCm39) I700T possibly damaging Het
Cfap65 A G 1: 74,949,902 (GRCm39) L1201P probably damaging Het
Chsy3 C T 18: 59,308,941 (GRCm39) Q65* probably null Het
Clic5 T A 17: 44,586,228 (GRCm39) L239* probably null Het
Corin T C 5: 72,462,361 (GRCm39) D957G probably damaging Het
Cped1 A T 6: 22,132,277 (GRCm39) Y486F probably damaging Het
Csnk1g3 C T 18: 54,081,151 (GRCm39) T374M probably benign Het
D930020B18Rik T A 10: 121,503,429 (GRCm39) C201* probably null Het
Dnah2 A G 11: 69,326,193 (GRCm39) F3653L probably damaging Het
F11r GGTGTG GGTGTGTG 1: 171,290,656 (GRCm39) probably null Het
Foxj3 T G 4: 119,478,808 (GRCm39) S455R unknown Het
Gcnt3 T C 9: 69,941,455 (GRCm39) D371G probably damaging Het
Gm10837 A G 14: 122,728,193 (GRCm39) E23G unknown Het
Hivep3 T C 4: 119,980,098 (GRCm39) V1712A probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hoxa2 A G 6: 52,140,041 (GRCm39) V315A probably damaging Het
Irx5 A T 8: 93,086,241 (GRCm39) Y108F possibly damaging Het
Itsn1 T C 16: 91,608,996 (GRCm39) I248T probably damaging Het
Kcnb1 T C 2: 166,946,361 (GRCm39) K829R probably benign Het
Klhl17 A G 4: 156,314,510 (GRCm39) V635A unknown Het
Krr1 C T 10: 111,815,834 (GRCm39) R234* probably null Het
Lrrc7 A T 3: 157,915,387 (GRCm39) D209E probably benign Het
Mcm2 T C 6: 88,874,293 (GRCm39) E71G probably damaging Het
Mroh5 C A 15: 73,691,139 (GRCm39) K10N probably damaging Het
Myh3 A G 11: 66,992,005 (GRCm39) E1850G probably damaging Het
Nedd9 T C 13: 41,492,319 (GRCm39) I64V probably benign Het
Nisch A G 14: 30,908,658 (GRCm39) S456P possibly damaging Het
Nrcam T C 12: 44,610,896 (GRCm39) V532A probably benign Het
Or51k1 T C 7: 103,661,330 (GRCm39) D193G possibly damaging Het
Or5p51 T G 7: 107,444,124 (GRCm39) D272A probably damaging Het
Or7g32 T C 9: 19,408,796 (GRCm39) F251L probably damaging Het
Or8k17 C T 2: 86,066,862 (GRCm39) V106M probably benign Het
Plekhg1 C T 10: 3,907,521 (GRCm39) P868S Het
Ptf1a A G 2: 19,450,760 (GRCm39) Q30R possibly damaging Het
Ptgs1 G T 2: 36,141,179 (GRCm39) C542F probably damaging Het
Rere T A 4: 150,701,424 (GRCm39) M1268K possibly damaging Het
Rp1 A G 1: 4,315,318 (GRCm39) F485L unknown Het
Samd14 A T 11: 94,905,213 (GRCm39) E8D probably benign Het
Serpinh1 A G 7: 98,995,545 (GRCm39) Y346H possibly damaging Het
Shq1 A T 6: 100,648,021 (GRCm39) M1K probably null Het
Tfrc T C 16: 32,443,848 (GRCm39) S551P probably damaging Het
Tnr A C 1: 159,715,860 (GRCm39) N874T possibly damaging Het
Trak1 C A 9: 121,298,096 (GRCm39) T667N probably damaging Het
Trpv2 A C 11: 62,481,757 (GRCm39) T423P probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Vmn2r24 A G 6: 123,756,077 (GRCm39) T50A probably benign Het
Xirp2 T A 2: 67,346,853 (GRCm39) D3031E probably benign Het
Zbed6 G T 1: 133,586,530 (GRCm39) A269E probably damaging Het
Zbtb4 A C 11: 69,669,598 (GRCm39) I774L probably benign Het
Zbtb47 T C 9: 121,596,344 (GRCm39) S604P probably benign Het
Zfhx3 A G 8: 109,677,349 (GRCm39) T2800A probably benign Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 57,977,257 (GRCm39) splice site probably benign
IGL01403:Ccdc33 APN 9 58,024,668 (GRCm39) missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58,024,919 (GRCm39) splice site probably benign
IGL01714:Ccdc33 APN 9 57,937,153 (GRCm39) missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 57,983,861 (GRCm39) missense probably benign 0.13
IGL02158:Ccdc33 APN 9 57,937,702 (GRCm39) missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 57,940,938 (GRCm39) missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58,005,874 (GRCm39) missense probably benign 0.43
R0276:Ccdc33 UTSW 9 57,965,675 (GRCm39) missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58,024,737 (GRCm39) missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 57,989,331 (GRCm39) missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58,024,497 (GRCm39) splice site probably benign
R0791:Ccdc33 UTSW 9 57,936,046 (GRCm39) missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 57,940,955 (GRCm39) missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58,024,749 (GRCm39) missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58,024,729 (GRCm39) missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 57,939,991 (GRCm39) missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58,024,445 (GRCm39) nonsense probably null
R1982:Ccdc33 UTSW 9 58,024,451 (GRCm39) missense probably benign 0.07
R2044:Ccdc33 UTSW 9 57,938,395 (GRCm39) missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 57,983,913 (GRCm39) missense probably benign 0.44
R3899:Ccdc33 UTSW 9 57,940,200 (GRCm39) missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 57,977,155 (GRCm39) missense possibly damaging 0.67
R4468:Ccdc33 UTSW 9 57,937,235 (GRCm39) missense possibly damaging 0.93
R4703:Ccdc33 UTSW 9 57,940,953 (GRCm39) missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58,024,840 (GRCm39) missense probably benign 0.01
R4790:Ccdc33 UTSW 9 57,937,240 (GRCm39) missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 57,974,818 (GRCm39) missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 57,974,839 (GRCm39) missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 57,977,134 (GRCm39) missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58,025,918 (GRCm39) missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 57,940,267 (GRCm39) missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 57,993,860 (GRCm39) missense probably benign 0.00
R5528:Ccdc33 UTSW 9 57,936,078 (GRCm39) missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58,024,450 (GRCm39) missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 57,937,235 (GRCm39) missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 57,940,489 (GRCm39) splice site probably benign
R5975:Ccdc33 UTSW 9 58,024,761 (GRCm39) missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 57,993,883 (GRCm39) missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58,009,201 (GRCm39) splice site probably null
R6363:Ccdc33 UTSW 9 58,021,618 (GRCm39) missense probably benign 0.00
R6610:Ccdc33 UTSW 9 57,976,419 (GRCm39) missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 57,940,527 (GRCm39) missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58,019,267 (GRCm39) makesense probably null
R7121:Ccdc33 UTSW 9 57,988,167 (GRCm39) missense probably benign 0.00
R7182:Ccdc33 UTSW 9 57,941,456 (GRCm39) splice site probably null
R7239:Ccdc33 UTSW 9 57,940,192 (GRCm39) nonsense probably null
R7655:Ccdc33 UTSW 9 58,025,748 (GRCm39) missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58,025,748 (GRCm39) missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 57,976,374 (GRCm39) missense probably benign
R9139:Ccdc33 UTSW 9 57,983,842 (GRCm39) missense probably benign 0.04
R9204:Ccdc33 UTSW 9 57,938,388 (GRCm39) missense probably benign 0.33
R9280:Ccdc33 UTSW 9 57,965,549 (GRCm39) missense probably benign
R9297:Ccdc33 UTSW 9 57,993,876 (GRCm39) missense possibly damaging 0.85
R9318:Ccdc33 UTSW 9 57,993,876 (GRCm39) missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58,024,908 (GRCm39) missense possibly damaging 0.96
R9664:Ccdc33 UTSW 9 57,993,855 (GRCm39) missense possibly damaging 0.85
RF003:Ccdc33 UTSW 9 57,965,574 (GRCm39) missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58,024,699 (GRCm39) missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58,025,868 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGATCACCATGGAAGCTCTCAG -3'
(R):5'- TGCAGAAGATGAAGGCCCTG -3'

Sequencing Primer
(F):5'- ACCATGGAAGCTCTCAGTACTTG -3'
(R):5'- TGGAGGACACTGTACGGCAC -3'
Posted On 2020-07-13