Incidental Mutation 'R8215:Ccdc33'
ID636374
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Namecoiled-coil domain containing 33
SynonymsLOC382077, 4930535E21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8215 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location58028677-58118823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58032712 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 749 (S749T)
Ref Sequence ENSEMBL: ENSMUSP00000096279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665]
Predicted Effect probably benign
Transcript: ENSMUST00000042205
AA Change: S564T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: S564T

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
AA Change: S749T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: S749T

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119665
AA Change: S563T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: S563T

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,065,100 R1066L probably benign Het
Abca14 A C 7: 120,294,202 I1292L probably benign Het
Adamtsl1 T G 4: 86,343,145 F1206V probably benign Het
Agl T C 3: 116,788,644 H243R probably damaging Het
Btn2a2 A C 13: 23,481,870 L264R probably damaging Het
Ccdc108 A G 1: 74,910,743 L1201P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Chsy3 C T 18: 59,175,869 Q65* probably null Het
Clic5 T A 17: 44,275,341 L239* probably null Het
Corin T C 5: 72,305,018 D957G probably damaging Het
Cped1 A T 6: 22,132,278 Y486F probably damaging Het
Csnk1g3 C T 18: 53,948,079 T374M probably benign Het
D930020B18Rik T A 10: 121,667,524 C201* probably null Het
Dnah2 A G 11: 69,435,367 F3653L probably damaging Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Foxj3 T G 4: 119,621,611 S455R unknown Het
Gcnt3 T C 9: 70,034,173 D371G probably damaging Het
Gm10837 A G 14: 122,490,781 E23G unknown Het
Gm38394 G T 1: 133,658,792 A269E probably damaging Het
Gm5346 T A 8: 43,626,501 T229S probably benign Het
Hivep3 T C 4: 120,122,901 V1712A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A G 6: 52,163,061 V315A probably damaging Het
Irx5 A T 8: 92,359,613 Y108F possibly damaging Het
Itsn1 T C 16: 91,812,108 I248T probably damaging Het
Kcnb1 T C 2: 167,104,441 K829R probably benign Het
Klhl17 A G 4: 156,230,053 V635A unknown Het
Krr1 C T 10: 111,979,929 R234* probably null Het
Lrrc7 A T 3: 158,209,750 D209E probably benign Het
Mcm2 T C 6: 88,897,311 E71G probably damaging Het
Mroh5 C A 15: 73,819,290 K10N probably damaging Het
Myh3 A G 11: 67,101,179 E1850G probably damaging Het
Nedd9 T C 13: 41,338,843 I64V probably benign Het
Nisch A G 14: 31,186,701 S456P possibly damaging Het
Nrcam T C 12: 44,564,113 V532A probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr470 T G 7: 107,844,917 D272A probably damaging Het
Olfr639 T C 7: 104,012,123 D193G possibly damaging Het
Olfr851 T C 9: 19,497,500 F251L probably damaging Het
Plekhg1 C T 10: 3,957,521 P868S Het
Ptf1a A G 2: 19,445,949 Q30R possibly damaging Het
Ptgs1 G T 2: 36,251,167 C542F probably damaging Het
Rere T A 4: 150,616,967 M1268K possibly damaging Het
Rp1 A G 1: 4,245,095 F485L unknown Het
Samd14 A T 11: 95,014,387 E8D probably benign Het
Serpinh1 A G 7: 99,346,338 Y346H possibly damaging Het
Shq1 A T 6: 100,671,060 M1K probably null Het
Tfrc T C 16: 32,625,030 S551P probably damaging Het
Tnr A C 1: 159,888,290 N874T possibly damaging Het
Trak1 C A 9: 121,469,030 T667N probably damaging Het
Trpv2 A C 11: 62,590,931 T423P probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r24 A G 6: 123,779,118 T50A probably benign Het
Xirp2 T A 2: 67,516,509 D3031E probably benign Het
Zbtb4 A C 11: 69,778,772 I774L probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfp651 T C 9: 121,767,278 S604P probably benign Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 splice site probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 58069091 missense probably benign
RF003:Ccdc33 UTSW 9 58058291 missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58117416 missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58118585 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGATCACCATGGAAGCTCTCAG -3'
(R):5'- TGCAGAAGATGAAGGCCCTG -3'

Sequencing Primer
(F):5'- ACCATGGAAGCTCTCAGTACTTG -3'
(R):5'- TGGAGGACACTGTACGGCAC -3'
Posted On2020-07-13