Incidental Mutation 'R8215:Trak1'
ID636376
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Nametrafficking protein, kinesin binding 1
Synonymshyrt, 2310001H13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R8215 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location121297502-121474918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121469030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 667 (T667N)
Ref Sequence ENSEMBL: ENSMUSP00000044482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210798] [ENSMUST00000211301]
Predicted Effect probably damaging
Transcript: ENSMUST00000045903
AA Change: T667N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: T667N

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209446
Predicted Effect probably damaging
Transcript: ENSMUST00000210798
AA Change: T564N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211301
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,065,100 R1066L probably benign Het
Abca14 A C 7: 120,294,202 I1292L probably benign Het
Adamtsl1 T G 4: 86,343,145 F1206V probably benign Het
Agl T C 3: 116,788,644 H243R probably damaging Het
Btn2a2 A C 13: 23,481,870 L264R probably damaging Het
Ccdc108 A G 1: 74,910,743 L1201P probably damaging Het
Ccdc33 A T 9: 58,032,712 S749T probably benign Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Chsy3 C T 18: 59,175,869 Q65* probably null Het
Clic5 T A 17: 44,275,341 L239* probably null Het
Corin T C 5: 72,305,018 D957G probably damaging Het
Cped1 A T 6: 22,132,278 Y486F probably damaging Het
Csnk1g3 C T 18: 53,948,079 T374M probably benign Het
D930020B18Rik T A 10: 121,667,524 C201* probably null Het
Dnah2 A G 11: 69,435,367 F3653L probably damaging Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Foxj3 T G 4: 119,621,611 S455R unknown Het
Gcnt3 T C 9: 70,034,173 D371G probably damaging Het
Gm10837 A G 14: 122,490,781 E23G unknown Het
Gm38394 G T 1: 133,658,792 A269E probably damaging Het
Gm5346 T A 8: 43,626,501 T229S probably benign Het
Hivep3 T C 4: 120,122,901 V1712A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A G 6: 52,163,061 V315A probably damaging Het
Irx5 A T 8: 92,359,613 Y108F possibly damaging Het
Itsn1 T C 16: 91,812,108 I248T probably damaging Het
Kcnb1 T C 2: 167,104,441 K829R probably benign Het
Klhl17 A G 4: 156,230,053 V635A unknown Het
Krr1 C T 10: 111,979,929 R234* probably null Het
Lrrc7 A T 3: 158,209,750 D209E probably benign Het
Mcm2 T C 6: 88,897,311 E71G probably damaging Het
Mroh5 C A 15: 73,819,290 K10N probably damaging Het
Myh3 A G 11: 67,101,179 E1850G probably damaging Het
Nedd9 T C 13: 41,338,843 I64V probably benign Het
Nisch A G 14: 31,186,701 S456P possibly damaging Het
Nrcam T C 12: 44,564,113 V532A probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr470 T G 7: 107,844,917 D272A probably damaging Het
Olfr639 T C 7: 104,012,123 D193G possibly damaging Het
Olfr851 T C 9: 19,497,500 F251L probably damaging Het
Plekhg1 C T 10: 3,957,521 P868S Het
Ptf1a A G 2: 19,445,949 Q30R possibly damaging Het
Ptgs1 G T 2: 36,251,167 C542F probably damaging Het
Rere T A 4: 150,616,967 M1268K possibly damaging Het
Rp1 A G 1: 4,245,095 F485L unknown Het
Samd14 A T 11: 95,014,387 E8D probably benign Het
Serpinh1 A G 7: 99,346,338 Y346H possibly damaging Het
Shq1 A T 6: 100,671,060 M1K probably null Het
Tfrc T C 16: 32,625,030 S551P probably damaging Het
Tnr A C 1: 159,888,290 N874T possibly damaging Het
Trpv2 A C 11: 62,590,931 T423P probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r24 A G 6: 123,779,118 T50A probably benign Het
Xirp2 T A 2: 67,516,509 D3031E probably benign Het
Zbtb4 A C 11: 69,778,772 I774L probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfp651 T C 9: 121,767,278 S604P probably benign Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121443736 critical splice donor site probably null
IGL01335:Trak1 APN 9 121454316 missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121431560 splice site probably null
IGL01804:Trak1 APN 9 121442685 splice site probably benign
IGL01986:Trak1 APN 9 121472967 missense probably benign 0.00
IGL02248:Trak1 APN 9 121446794 missense probably damaging 1.00
IGL02276:Trak1 APN 9 121451668 missense probably damaging 1.00
IGL02556:Trak1 APN 9 121448901 missense probably damaging 1.00
IGL03368:Trak1 APN 9 121367122 missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121453332 missense probably benign 0.18
R0067:Trak1 UTSW 9 121472907 missense probably damaging 1.00
R0276:Trak1 UTSW 9 121454338 missense probably damaging 0.97
R0535:Trak1 UTSW 9 121443712 missense probably null 1.00
R0629:Trak1 UTSW 9 121367167 missense probably benign 0.37
R0671:Trak1 UTSW 9 121448955 critical splice donor site probably null
R0883:Trak1 UTSW 9 121453285 missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121392007 missense probably benign 0.01
R1162:Trak1 UTSW 9 121453341 missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121440679 missense probably damaging 1.00
R1398:Trak1 UTSW 9 121454359 missense probably damaging 1.00
R2118:Trak1 UTSW 9 121472997 makesense probably null
R2119:Trak1 UTSW 9 121472997 makesense probably null
R2120:Trak1 UTSW 9 121472997 makesense probably null
R2137:Trak1 UTSW 9 121472962 missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121451734 splice site probably benign
R3888:Trak1 UTSW 9 121442797 splice site probably null
R3889:Trak1 UTSW 9 121445873 missense probably null 0.40
R4031:Trak1 UTSW 9 121451670 missense probably damaging 1.00
R4116:Trak1 UTSW 9 121448843 missense probably damaging 1.00
R4406:Trak1 UTSW 9 121431536 missense probably damaging 1.00
R4630:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4631:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4632:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4786:Trak1 UTSW 9 121472494 missense probably benign 0.25
R5137:Trak1 UTSW 9 121367055 intron probably benign
R5159:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R5467:Trak1 UTSW 9 121446798 missense probably damaging 1.00
R5661:Trak1 UTSW 9 121443637 missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121472307 missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121448838 missense probably damaging 1.00
R6041:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R6257:Trak1 UTSW 9 121446755 missense probably damaging 1.00
R6257:Trak1 UTSW 9 121367224 missense possibly damaging 0.92
R6354:Trak1 UTSW 9 121451726 missense probably null 0.03
R6399:Trak1 UTSW 9 121453496 splice site probably null
R6513:Trak1 UTSW 9 121443756 missense probably benign
R6579:Trak1 UTSW 9 121443638 missense probably benign 0.29
R6940:Trak1 UTSW 9 121443718 missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121460498 missense probably benign
R7299:Trak1 UTSW 9 121451863 splice site probably null
R7304:Trak1 UTSW 9 121416212 missense probably benign
R7396:Trak1 UTSW 9 121448907 missense possibly damaging 0.71
R7522:Trak1 UTSW 9 121442711 missense probably damaging 0.99
R7657:Trak1 UTSW 9 121472586 missense probably damaging 1.00
R7733:Trak1 UTSW 9 121367225 missense possibly damaging 0.92
R7793:Trak1 UTSW 9 121416198 nonsense probably null
R7999:Trak1 UTSW 9 121460425 missense probably damaging 1.00
R8209:Trak1 UTSW 9 121451727 missense probably benign
R8226:Trak1 UTSW 9 121451727 missense probably benign
R8261:Trak1 UTSW 9 121451667 missense probably damaging 1.00
R8300:Trak1 UTSW 9 121460499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAGATCCAGTTGACAAGG -3'
(R):5'- AAGATGCTTAAGCCTGTTGGG -3'

Sequencing Primer
(F):5'- TTGACAAGGTAGCCCATCG -3'
(R):5'- ATTACGTAGATCAGGCTGGCCTAC -3'
Posted On2020-07-13