Incidental Mutation 'R0725:Pkp1'
ID63639
Institutional Source Beutler Lab
Gene Symbol Pkp1
Ensembl Gene ENSMUSG00000026413
Gene Nameplakophilin 1
Synonyms
MMRRC Submission 038907-MU
Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R0725 (G1)
Quality Score83
Status Validated
Chromosome1
Chromosomal Location135871395-135919207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 135880740 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 496 (N496K)
Ref Sequence ENSEMBL: ENSMUSP00000128418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]
Predicted Effect probably benign
Transcript: ENSMUST00000027667
AA Change: N496K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: N496K

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132793
Predicted Effect probably benign
Transcript: ENSMUST00000163260
AA Change: N496K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: N496K

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189805
SMART Domains Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,027,143 D131E probably damaging Het
Asph C T 4: 9,542,275 D305N probably damaging Het
Atp13a3 T C 16: 30,351,387 K327R probably damaging Het
Cacna1s T C 1: 136,098,526 probably benign Het
Ccnk T C 12: 108,195,575 probably benign Het
Cep55 T C 19: 38,060,174 S93P possibly damaging Het
Cfh A G 1: 140,157,343 probably benign Het
Clptm1l A G 13: 73,606,343 T129A probably benign Het
Cntnap5a A G 1: 116,292,476 E672G probably benign Het
Cpped1 C A 16: 11,828,450 W170L probably damaging Het
Crygb T C 1: 65,081,941 I76V probably benign Het
Cyp3a25 A G 5: 145,994,936 S121P probably damaging Het
Cyp4b1 T C 4: 115,626,827 D395G probably damaging Het
Dll4 T C 2: 119,332,689 V597A probably damaging Het
Dock7 T C 4: 98,945,291 D1891G probably damaging Het
Dsel T C 1: 111,859,952 D951G possibly damaging Het
Dync2h1 C A 9: 7,015,497 V3603F possibly damaging Het
Fam109a T A 5: 121,853,251 H225Q probably benign Het
Fam129a A G 1: 151,706,015 E454G probably benign Het
Fam167b C A 4: 129,578,285 A31S probably damaging Het
Fgfrl1 T A 5: 108,704,673 I25N probably damaging Het
Gzf1 C T 2: 148,684,649 R347* probably null Het
Heatr5b T A 17: 78,796,396 I1117F probably benign Het
Kntc1 T C 5: 123,769,704 V456A possibly damaging Het
Macc1 C A 12: 119,447,516 S673* probably null Het
Mpp4 T C 1: 59,121,422 E574G probably damaging Het
Muc20 C T 16: 32,793,488 M506I probably benign Het
Ncbp1 A G 4: 46,152,056 T218A probably benign Het
Nfxl1 A T 5: 72,559,130 V46E probably benign Het
Nfyc G T 4: 120,768,734 probably benign Het
Olfr561 T A 7: 102,774,532 S3T probably benign Het
Olfr972 A T 9: 39,873,347 Q24L probably damaging Het
Osbpl8 T C 10: 111,286,240 F681S possibly damaging Het
Pcm1 G C 8: 41,287,811 E1031D probably damaging Het
Pdcd11 A G 19: 47,127,291 E1486G probably benign Het
Pex12 G T 11: 83,298,034 A45E probably damaging Het
Pigm A G 1: 172,376,817 D40G probably damaging Het
Psmc4 T C 7: 28,048,862 I54V probably benign Het
Rbm33 T C 5: 28,394,483 V951A unknown Het
Selenbp2 G T 3: 94,697,502 probably benign Het
Slc3a1 G A 17: 85,060,835 W510* probably null Het
Stx12 A C 4: 132,857,390 probably benign Het
Tas2r125 G T 6: 132,910,122 D158Y probably benign Het
Tchp C A 5: 114,719,621 Q392K probably benign Het
Tmed11 T A 5: 108,778,989 D139V probably damaging Het
Ttn C T 2: 76,748,310 V24080M probably damaging Het
Ush2a G A 1: 188,951,525 G4967D probably damaging Het
Vezf1 T C 11: 88,073,330 S103P probably benign Het
Xpnpep3 T C 15: 81,430,842 S248P probably damaging Het
Yipf2 G C 9: 21,592,223 probably null Het
Zfp110 A T 7: 12,836,363 Q39L possibly damaging Het
Zfp287 A T 11: 62,714,213 C623S probably damaging Het
Other mutations in Pkp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Pkp1 APN 1 135878184 missense probably damaging 0.96
IGL02113:Pkp1 APN 1 135883914 missense possibly damaging 0.92
IGL02149:Pkp1 APN 1 135886747 missense probably benign 0.00
IGL02582:Pkp1 APN 1 135889926 missense probably damaging 0.99
IGL02655:Pkp1 APN 1 135889773 missense probably benign 0.14
IGL03166:Pkp1 APN 1 135878124 missense probably damaging 1.00
P0008:Pkp1 UTSW 1 135875683 missense probably benign 0.00
R0180:Pkp1 UTSW 1 135886800 missense probably benign 0.00
R0368:Pkp1 UTSW 1 135875683 missense probably benign
R0368:Pkp1 UTSW 1 135886852 missense probably benign 0.00
R0601:Pkp1 UTSW 1 135878182 missense probably damaging 1.00
R1414:Pkp1 UTSW 1 135884085 splice site probably benign
R1926:Pkp1 UTSW 1 135877673 missense probably benign
R2082:Pkp1 UTSW 1 135884976 missense possibly damaging 0.48
R2190:Pkp1 UTSW 1 135879971 missense probably benign 0.02
R2249:Pkp1 UTSW 1 135880807 missense probably damaging 1.00
R4457:Pkp1 UTSW 1 135875624 makesense probably null
R4838:Pkp1 UTSW 1 135882588 missense probably damaging 1.00
R4885:Pkp1 UTSW 1 135918952 missense possibly damaging 0.92
R4995:Pkp1 UTSW 1 135880855 missense possibly damaging 0.91
R5436:Pkp1 UTSW 1 135918918 missense probably damaging 1.00
R5440:Pkp1 UTSW 1 135882492 missense probably benign 0.41
R5652:Pkp1 UTSW 1 135882597 critical splice acceptor site probably null
R5898:Pkp1 UTSW 1 135882521 missense probably damaging 1.00
R5908:Pkp1 UTSW 1 135918883 nonsense probably null
R6006:Pkp1 UTSW 1 135877668 splice site probably null
R6013:Pkp1 UTSW 1 135883910 missense probably damaging 1.00
R6218:Pkp1 UTSW 1 135879908 missense probably damaging 0.96
R6232:Pkp1 UTSW 1 135886861 missense probably benign 0.01
R7000:Pkp1 UTSW 1 135889954 missense probably benign 0.41
R7799:Pkp1 UTSW 1 135889957 missense possibly damaging 0.94
R7883:Pkp1 UTSW 1 135884903 critical splice donor site probably null
R7966:Pkp1 UTSW 1 135884903 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCCACTACACAGTGAGAGGAATG -3'
(R):5'- CTGTTGGGACAGTACTCAGGCATC -3'

Sequencing Primer
(F):5'- GGGCTGCTACAGCTTATGTG -3'
(R):5'- GACAGTACTCAGGCATCCTCTC -3'
Posted On2013-07-30