Incidental Mutation 'R8217:Cd55b'
ID636399
Institutional Source Beutler Lab
Gene Symbol Cd55b
Ensembl Gene ENSMUSG00000026401
Gene NameCD55 molecule, decay accelerating factor for complement B
SynonymsDaf2, TM-DAF, complement-transmembrane, Daf-TM
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8217 (G1)
Quality Score142.467
Status Validated
Chromosome1
Chromosomal Location130388537-130423009 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTTTT to CTTTTT at 130419600 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112488] [ENSMUST00000119432]
Predicted Effect probably null
Transcript: ENSMUST00000112488
SMART Domains Protein: ENSMUSP00000108107
Gene: ENSMUSG00000026401

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 92 2.21e-12 SMART
CCP 96 156 1.47e-8 SMART
CCP 161 218 1.56e-12 SMART
CCP 223 282 2.19e-16 SMART
low complexity region 287 298 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119432
SMART Domains Protein: ENSMUSP00000113352
Gene: ENSMUSG00000026401

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 92 2.21e-12 SMART
CCP 96 156 1.47e-8 SMART
CCP 161 218 1.56e-12 SMART
transmembrane domain 247 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes an inhibitor of both the classical and the alternative pathways of complement activation. This gene is located adjacent to a closely related gene on chromosome 1 and preferentially expressed in the spleen and testis. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Cd55b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Cd55b APN 1 130422906 missense possibly damaging 0.86
IGL02086:Cd55b APN 1 130418182 missense probably benign 0.05
IGL02629:Cd55b APN 1 130419798 splice site probably benign
IGL02735:Cd55b APN 1 130388676 missense probably damaging 0.98
IGL03212:Cd55b APN 1 130411442 missense probably benign 0.15
R0827:Cd55b UTSW 1 130414236 missense probably damaging 0.96
R0961:Cd55b UTSW 1 130414076 missense probably damaging 1.00
R1381:Cd55b UTSW 1 130419675 missense probably damaging 1.00
R1762:Cd55b UTSW 1 130388655 nonsense probably null
R1839:Cd55b UTSW 1 130414105 missense probably damaging 1.00
R1940:Cd55b UTSW 1 130418106 critical splice donor site probably null
R2359:Cd55b UTSW 1 130418121 missense probably damaging 1.00
R2504:Cd55b UTSW 1 130409875 missense probably damaging 1.00
R4282:Cd55b UTSW 1 130416859 missense probably damaging 0.99
R6276:Cd55b UTSW 1 130418166 missense probably damaging 1.00
R6306:Cd55b UTSW 1 130414066 missense probably damaging 0.99
R6977:Cd55b UTSW 1 130419791 missense probably damaging 0.96
R7026:Cd55b UTSW 1 130388690 missense probably benign 0.06
R7528:Cd55b UTSW 1 130419736 missense possibly damaging 0.95
R7726:Cd55b UTSW 1 130411493 missense possibly damaging 0.48
R8215:Cd55b UTSW 1 130419600 frame shift probably null
R8260:Cd55b UTSW 1 130388678 missense probably damaging 0.99
R8353:Cd55b UTSW 1 130414133 missense probably benign 0.00
R8467:Cd55b UTSW 1 130419764 missense possibly damaging 0.89
R8960:Cd55b UTSW 1 130410638 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCTCTGAGCCACTGATAATTTCTAACC -3'
(R):5'- AGACTGAGTTTTGCATCCCTC -3'

Sequencing Primer
(F):5'- ATTGCCTCATAAAAGCAAGGTAC -3'
(R):5'- GGCCAGGATTTCGAAAAC -3'
Posted On2020-07-13