Incidental Mutation 'R8217:Rap2b'
ID636404
Institutional Source Beutler Lab
Gene Symbol Rap2b
Ensembl Gene ENSMUSG00000036894
Gene NameRAP2B, member of RAS oncogene family
Synonyms4021402C18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location61361638-61368430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61365130 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 25 (T25K)
Ref Sequence ENSEMBL: ENSMUSP00000038841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049064] [ENSMUST00000066298]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049064
AA Change: T25K

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038841
Gene: ENSMUSG00000036894
AA Change: T25K

DomainStartEndE-ValueType
RAS 1 167 3.08e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066298
SMART Domains Protein: ENSMUSP00000070175
Gene: ENSMUSG00000053706

DomainStartEndE-ValueType
low complexity region 95 103 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene belongs to a family of RAS-related genes. The proteins encoded by these genes share approximately 50% amino acid identity with the classical RAS proteins and have numerous structural features in common. The most striking difference between the RAP and RAS proteins resides in their 61st amino acid: glutamine in RAS is replaced by threonine in RAP proteins. Evidence suggests that this protein may be polyisoprenylated and palmitoylated. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Rap2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Rap2b APN 3 61365139 missense probably damaging 1.00
R1715:Rap2b UTSW 3 61365190 missense probably damaging 0.98
R2117:Rap2b UTSW 3 61365091 missense probably damaging 1.00
R8420:Rap2b UTSW 3 61364384 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- TTTTCCTGCGAAGTTGAGGAAG -3'
(R):5'- TACCAGGATCATGGGTACGC -3'

Sequencing Primer
(F):5'- GGGGAGAAGTCCACCCGTC -3'
(R):5'- AAGCTCTGCTGGTTGACC -3'
Posted On2020-07-13