Incidental Mutation 'R8217:Tlr2'
ID636405
Institutional Source Beutler Lab
Gene Symbol Tlr2
Ensembl Gene ENSMUSG00000027995
Gene Nametoll-like receptor 2
SynonymsLy105
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location83836272-83841767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83838066 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 237 (F237L)
Ref Sequence ENSEMBL: ENSMUSP00000029623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029623]
Predicted Effect probably benign
Transcript: ENSMUST00000029623
AA Change: F237L

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029623
Gene: ENSMUSG00000027995
AA Change: F237L

DomainStartEndE-ValueType
LRR 51 74 1.45e2 SMART
LRR 75 98 2.33e2 SMART
LRR_TYP 99 122 3.69e-4 SMART
low complexity region 268 281 N/A INTRINSIC
LRR 359 384 6.78e1 SMART
LRR 386 409 2.54e2 SMART
LRR 412 435 8.49e1 SMART
LRR_TYP 476 499 3.34e-2 SMART
LRRCT 533 586 5.04e-7 SMART
transmembrane domain 588 610 N/A INTRINSIC
TIR 640 784 5.08e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice demonstrate abnormal responses to bacterial and viral infections. Mice homozygous for a knock-out allele also exhibit disruption in circadian active and inactive state consolidation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Tlr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Tlr2 APN 3 83836994 missense probably benign
IGL02160:Tlr2 APN 3 83837371 missense possibly damaging 0.47
IGL02405:Tlr2 APN 3 83836674 missense probably damaging 1.00
IGL02940:Tlr2 APN 3 83836474 missense probably benign 0.03
IGL03165:Tlr2 APN 3 83837948 missense probably benign 0.00
languid UTSW 3 83837315 missense probably damaging 1.00
G1patch:Tlr2 UTSW 3 83838296 missense probably benign
PIT4131001:Tlr2 UTSW 3 83838449 missense probably benign 0.34
R1177:Tlr2 UTSW 3 83838734 missense probably benign 0.02
R1251:Tlr2 UTSW 3 83838269 missense possibly damaging 0.64
R1346:Tlr2 UTSW 3 83836593 missense probably damaging 0.99
R1553:Tlr2 UTSW 3 83837463 missense probably benign
R1613:Tlr2 UTSW 3 83837353 missense probably damaging 1.00
R1816:Tlr2 UTSW 3 83838209 missense probably damaging 1.00
R2312:Tlr2 UTSW 3 83837540 missense probably damaging 1.00
R3023:Tlr2 UTSW 3 83837871 missense probably benign
R4724:Tlr2 UTSW 3 83838185 missense probably damaging 1.00
R4950:Tlr2 UTSW 3 83837332 missense probably damaging 1.00
R5109:Tlr2 UTSW 3 83837723 missense probably damaging 1.00
R5764:Tlr2 UTSW 3 83838512 missense probably damaging 1.00
R5859:Tlr2 UTSW 3 83836503 missense possibly damaging 0.94
R6169:Tlr2 UTSW 3 83838148 missense probably benign
R6236:Tlr2 UTSW 3 83838131 missense probably benign
R6384:Tlr2 UTSW 3 83836994 missense probably benign
R6564:Tlr2 UTSW 3 83837695 missense probably benign 0.05
R6725:Tlr2 UTSW 3 83838296 missense probably benign
R7032:Tlr2 UTSW 3 83837905 missense probably benign 0.01
R7256:Tlr2 UTSW 3 83837606 missense possibly damaging 0.93
R7571:Tlr2 UTSW 3 83836542 missense probably damaging 1.00
R7970:Tlr2 UTSW 3 83837894 missense probably benign 0.01
R8191:Tlr2 UTSW 3 83836514 missense probably damaging 1.00
R8191:Tlr2 UTSW 3 83836515 missense probably damaging 0.99
R8218:Tlr2 UTSW 3 83838239 missense probably damaging 1.00
R8834:Tlr2 UTSW 3 83838713 missense probably benign
R8894:Tlr2 UTSW 3 83836784 missense probably damaging 1.00
R8922:Tlr2 UTSW 3 83837768 missense probably benign 0.02
Z1177:Tlr2 UTSW 3 83836607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCCGAGGGGTTGAAATC -3'
(R):5'- AATAGATTTTGCTGGGCTGACTTC -3'

Sequencing Primer
(F):5'- TTGAAATCGCCGAGCCCATTG -3'
(R):5'- GGGCTGACTTCTCTCAATGAAC -3'
Posted On2020-07-13