Incidental Mutation 'R8217:Cfi'
ID636406
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129855001 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 178 (N178T)
Ref Sequence ENSEMBL: ENSMUSP00000077074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077918
AA Change: N178T

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: N178T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200206
SMART Domains Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 2.2e-40 SMART
KAZAL 63 109 4.4e-5 SMART
Blast:SR 117 145 3e-11 BLAST
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 splice site probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4596:Cfi UTSW 3 129868500 missense probably damaging 0.98
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
R7000:Cfi UTSW 3 129872873 missense probably damaging 1.00
R7108:Cfi UTSW 3 129875016 missense probably damaging 1.00
R7194:Cfi UTSW 3 129855059 missense probably damaging 1.00
R7342:Cfi UTSW 3 129875132 missense probably damaging 1.00
R7470:Cfi UTSW 3 129855087 missense probably benign 0.01
R7538:Cfi UTSW 3 129858815 missense probably benign 0.08
R7908:Cfi UTSW 3 129848584 missense probably benign 0.01
R7954:Cfi UTSW 3 129868585 critical splice donor site probably null
R8017:Cfi UTSW 3 129855099 missense probably benign 0.00
R8135:Cfi UTSW 3 129855000 missense probably benign 0.00
R8155:Cfi UTSW 3 129855090 missense probably benign 0.00
R8530:Cfi UTSW 3 129850733 missense possibly damaging 0.79
R8767:Cfi UTSW 3 129850848 critical splice donor site probably null
V7580:Cfi UTSW 3 129854992 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCTTTCCAAAACCCCAGAGG -3'
(R):5'- GCTCCTATGAAACGAGTGATGTTG -3'

Sequencing Primer
(F):5'- CCCCAGAGGTATTAAGGCTTAAGTG -3'
(R):5'- CCTATGAAACGAGTGATGTTGATGGG -3'
Posted On2020-07-13