Incidental Mutation 'R8217:Sec24b'
ID636407
Institutional Source Beutler Lab
Gene Symbol Sec24b
Ensembl Gene ENSMUSG00000001052
Gene NameSec24 related gene family, member B (S. cerevisiae)
SynonymsSEC24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location129982759-130061553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130040950 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 200 (F200I)
Ref Sequence ENSEMBL: ENSMUSP00000001079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001079] [ENSMUST00000165873] [ENSMUST00000168644]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001079
AA Change: F200I

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001079
Gene: ENSMUSG00000001052
AA Change: F200I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 229 254 N/A INTRINSIC
low complexity region 316 333 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 363 373 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
low complexity region 450 473 N/A INTRINSIC
low complexity region 486 505 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 585 622 4.1e-17 PFAM
Pfam:Sec23_trunk 658 897 2.4e-87 PFAM
Pfam:Sec23_BS 902 986 3.4e-23 PFAM
Pfam:Sec23_helical 999 1099 8.7e-31 PFAM
Pfam:Gelsolin 1122 1197 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165873
SMART Domains Protein: ENSMUSP00000132861
Gene: ENSMUSG00000001052

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 115 123 N/A INTRINSIC
low complexity region 156 181 N/A INTRINSIC
low complexity region 187 210 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 321 359 2.5e-18 PFAM
Pfam:Sec23_trunk 395 634 1.6e-87 PFAM
Pfam:Sec23_BS 639 723 2.2e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168644
AA Change: F64I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126923
Gene: ENSMUSG00000001052
AA Change: F64I

DomainStartEndE-ValueType
low complexity region 93 118 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
low complexity region 249 257 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
low complexity region 321 344 N/A INTRINSIC
low complexity region 357 376 N/A INTRINSIC
PDB:3EH1|A 377 411 1e-11 PDB
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit craniorachischisis, abnormal embryo shape, omphalocele, disoriented hair cells, and failure of eyelid fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Sec24b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Sec24b APN 3 130020646 intron probably benign
IGL01137:Sec24b APN 3 130007444 missense probably benign 0.02
IGL01370:Sec24b APN 3 130007604 splice site probably benign
IGL01931:Sec24b APN 3 130009799 missense probably benign 0.00
PIT4696001:Sec24b UTSW 3 129994391 missense probably benign 0.01
R0193:Sec24b UTSW 3 129988984 missense probably null
R0194:Sec24b UTSW 3 129984165 critical splice donor site probably null
R0403:Sec24b UTSW 3 129989676 missense possibly damaging 0.81
R0403:Sec24b UTSW 3 129999534 missense probably damaging 1.00
R0576:Sec24b UTSW 3 130041336 missense probably benign 0.11
R0583:Sec24b UTSW 3 130041311 nonsense probably null
R0963:Sec24b UTSW 3 130040905 missense probably benign 0.02
R0967:Sec24b UTSW 3 129996782 missense probably damaging 1.00
R1344:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1418:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1594:Sec24b UTSW 3 129991351 missense probably benign 0.00
R1716:Sec24b UTSW 3 130041016 missense possibly damaging 0.89
R1938:Sec24b UTSW 3 129991361 missense possibly damaging 0.82
R2020:Sec24b UTSW 3 129987728 missense probably damaging 1.00
R2407:Sec24b UTSW 3 130002316 missense probably benign 0.02
R2415:Sec24b UTSW 3 129996080 missense probably benign 0.00
R3121:Sec24b UTSW 3 130002304 critical splice donor site probably null
R3729:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3731:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3789:Sec24b UTSW 3 130020627 missense probably benign 0.00
R4229:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4230:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4617:Sec24b UTSW 3 130040764 missense possibly damaging 0.94
R4856:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4886:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4913:Sec24b UTSW 3 130002379 missense probably benign 0.07
R5510:Sec24b UTSW 3 130040895 missense probably damaging 1.00
R5601:Sec24b UTSW 3 130040834 small insertion probably benign
R6167:Sec24b UTSW 3 129988901 missense possibly damaging 0.88
R6314:Sec24b UTSW 3 130007245 splice site probably null
R6442:Sec24b UTSW 3 129996701 missense probably damaging 1.00
R6512:Sec24b UTSW 3 130041297 missense probably damaging 1.00
R6743:Sec24b UTSW 3 130041232 missense probably damaging 0.98
R7081:Sec24b UTSW 3 129987742 missense probably benign 0.00
R7179:Sec24b UTSW 3 129988946 missense probably damaging 1.00
R7214:Sec24b UTSW 3 130033860 missense probably benign 0.19
R7332:Sec24b UTSW 3 130041393 missense probably benign 0.10
R7414:Sec24b UTSW 3 130009865 missense probably benign 0.01
R7599:Sec24b UTSW 3 130040811 small insertion probably benign
R7774:Sec24b UTSW 3 129984197 missense possibly damaging 0.88
R7895:Sec24b UTSW 3 129995949 missense probably benign 0.13
R8146:Sec24b UTSW 3 129995924 nonsense probably null
R8344:Sec24b UTSW 3 130005001 missense probably damaging 0.97
R8525:Sec24b UTSW 3 130011818 missense probably damaging 1.00
R8699:Sec24b UTSW 3 130005004 missense probably damaging 1.00
R8783:Sec24b UTSW 3 129989693 missense probably benign
X0065:Sec24b UTSW 3 129996355 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGATCCCATTTGGTTTCGG -3'
(R):5'- CCTCTCTTGGGAATCGCTACAG -3'

Sequencing Primer
(F):5'- GACCATGGTAGAGAACTATATCCTG -3'
(R):5'- TGGGAATCGCTACAGTAGTCCTAC -3'
Posted On2020-07-13