Incidental Mutation 'R8217:Perm1'
ID636408
Institutional Source Beutler Lab
Gene Symbol Perm1
Ensembl Gene ENSMUSG00000078486
Gene NamePPARGC1 and ESRR induced regulator, muscle 1
Synonyms2310042D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8217 (G1)
Quality Score132.491
Status Not validated
Chromosome4
Chromosomal Location156215868-156221307 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT at 156218068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105571
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217885
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Perm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL01970:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL02143:Perm1 APN 4 156218043 missense probably benign 0.09
IGL02644:Perm1 APN 4 156218586 missense probably damaging 1.00
IGL02993:Perm1 APN 4 156217779 missense probably benign 0.20
PIT4366001:Perm1 UTSW 4 156218735 missense probably benign 0.11
R0052:Perm1 UTSW 4 156218115 missense probably damaging 1.00
R0105:Perm1 UTSW 4 156218225 missense probably benign 0.23
R0566:Perm1 UTSW 4 156217859 missense probably benign 0.10
R1184:Perm1 UTSW 4 156217314 missense probably damaging 1.00
R1208:Perm1 UTSW 4 156217002 start codon destroyed probably null 0.92
R1244:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1724:Perm1 UTSW 4 156218072 missense possibly damaging 0.82
R1783:Perm1 UTSW 4 156218531 nonsense probably null
R1817:Perm1 UTSW 4 156218604 missense possibly damaging 0.59
R1892:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1893:Perm1 UTSW 4 156217883 missense probably benign 0.09
R2106:Perm1 UTSW 4 156218879 missense probably damaging 1.00
R2567:Perm1 UTSW 4 156217118 missense probably damaging 0.99
R3752:Perm1 UTSW 4 156217946 missense probably benign 0.01
R3934:Perm1 UTSW 4 156219170 missense probably benign
R4509:Perm1 UTSW 4 156217586 missense probably benign 0.02
R4667:Perm1 UTSW 4 156220206 nonsense probably null
R4706:Perm1 UTSW 4 156217074 missense probably damaging 0.99
R4812:Perm1 UTSW 4 156218736 missense possibly damaging 0.59
R4979:Perm1 UTSW 4 156217577 missense probably benign 0.01
R5275:Perm1 UTSW 4 156217518 missense probably benign
R5295:Perm1 UTSW 4 156217518 missense probably benign
R5425:Perm1 UTSW 4 156218295 missense probably benign 0.04
R6125:Perm1 UTSW 4 156217719 missense probably benign 0.00
R6573:Perm1 UTSW 4 156218673 missense probably damaging 1.00
R6721:Perm1 UTSW 4 156218319 missense probably benign 0.00
R6986:Perm1 UTSW 4 156218519 nonsense probably null
R7190:Perm1 UTSW 4 156219815 missense possibly damaging 0.84
R7561:Perm1 UTSW 4 156218760 missense probably benign
R7578:Perm1 UTSW 4 156218068 unclassified probably benign
R7769:Perm1 UTSW 4 156218068 unclassified probably benign
R7876:Perm1 UTSW 4 156217589 missense probably damaging 0.98
R7899:Perm1 UTSW 4 156218068 unclassified probably benign
R7943:Perm1 UTSW 4 156218534 missense probably damaging 0.98
R7979:Perm1 UTSW 4 156218068 unclassified probably benign
R8352:Perm1 UTSW 4 156218068 unclassified probably benign
R8680:Perm1 UTSW 4 156217634 missense probably benign
R8719:Perm1 UTSW 4 156218068 unclassified probably benign
R8753:Perm1 UTSW 4 156218068 unclassified probably benign
R8847:Perm1 UTSW 4 156217611 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGAAGTTCACCCAGATG -3'
(R):5'- AGGTCCACATGCAATCCAGG -3'

Sequencing Primer
(F):5'- GTGTCTACACGTGCCTCCAAG -3'
(R):5'- ACATGCAATCCAGGTGTGC -3'
Posted On2020-07-13