Incidental Mutation 'R8217:Acrbp'
ID636416
Institutional Source Beutler Lab
Gene Symbol Acrbp
Ensembl Gene ENSMUSG00000072770
Gene Nameproacrosin binding protein
Synonymssp32, OY-TES-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125049689-125063267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125060958 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 406 (L406P)
Ref Sequence ENSEMBL: ENSMUSP00000085632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088294]
Predicted Effect probably damaging
Transcript: ENSMUST00000088294
AA Change: L406P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085632
Gene: ENSMUSG00000072770
AA Change: L406P

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.6e-139 PFAM
KAZAL 466 506 1.42e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to proacrosin binding protein sp32 precursor found in mouse, guinea pig, and pig. This protein is located in the sperm acrosome and is thought to function as a binding protein to proacrosin for packaging and condensation of the acrosin zymogen in the acrosomal matrix. This protein is a member of the cancer/testis family of antigens and it is found to be immunogenic. In normal tissues, this mRNA is expressed only in testis, whereas it is detected in a range of different tumor types such as bladder, breast, lung, liver, and colon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in delayed fertilization due to a delay in sperm penetration of the zona pellucida. Homozygous sperm also show reduced fertilization rates of oocytes with a thick or hardened zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Acrbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Acrbp APN 6 125050514 missense probably damaging 1.00
IGL01656:Acrbp APN 6 125053712 missense possibly damaging 0.88
IGL02095:Acrbp APN 6 125053956 nonsense probably null
IGL02186:Acrbp APN 6 125054810 splice site probably null
IGL02473:Acrbp APN 6 125054698 missense probably benign
IGL02831:Acrbp APN 6 125061249 missense possibly damaging 0.89
IGL03110:Acrbp APN 6 125062473 missense probably damaging 0.99
R0071:Acrbp UTSW 6 125050952 unclassified probably benign
R0071:Acrbp UTSW 6 125050952 unclassified probably benign
R0279:Acrbp UTSW 6 125053954 critical splice donor site probably null
R0483:Acrbp UTSW 6 125054796 missense possibly damaging 0.61
R1017:Acrbp UTSW 6 125061260 splice site probably benign
R1486:Acrbp UTSW 6 125050622 missense probably damaging 1.00
R4679:Acrbp UTSW 6 125060918 missense probably damaging 0.96
R4898:Acrbp UTSW 6 125050538 missense probably damaging 0.97
R4987:Acrbp UTSW 6 125053762 missense probably benign 0.23
R5249:Acrbp UTSW 6 125060922 missense probably damaging 0.98
R5458:Acrbp UTSW 6 125050050 unclassified probably benign
R5579:Acrbp UTSW 6 125061099 missense probably benign 0.00
R6491:Acrbp UTSW 6 125051479 unclassified probably benign
R7643:Acrbp UTSW 6 125053832 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCGTCCTTACAGTATGCTCTG -3'
(R):5'- TTCTAGCCCAGCAAATCGTC -3'

Sequencing Primer
(F):5'- CCTTACAGTATGCTCTGGAGGTC -3'
(R):5'- AGCAAATCGTCCTTTATCTGGG -3'
Posted On2020-07-13