Incidental Mutation 'R8217:Slc9a5'
ID636423
Institutional Source Beutler Lab
Gene Symbol Slc9a5
Ensembl Gene ENSMUSG00000014786
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 5
SynonymsLOC277973
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105348843-105369881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105363324 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 638 (E638V)
Ref Sequence ENSEMBL: ENSMUSP00000072893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073149]
Predicted Effect probably damaging
Transcript: ENSMUST00000073149
AA Change: E638V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072893
Gene: ENSMUSG00000014786
AA Change: E638V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 39 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 458 9.8e-89 PFAM
low complexity region 705 723 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Slc9a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Slc9a5 APN 8 105349443 missense probably damaging 0.99
IGL02339:Slc9a5 APN 8 105358459 missense probably damaging 1.00
IGL03220:Slc9a5 APN 8 105368020 missense probably benign 0.09
P0026:Slc9a5 UTSW 8 105355291 missense probably damaging 1.00
R0680:Slc9a5 UTSW 8 105355907 missense probably null 1.00
R0990:Slc9a5 UTSW 8 105359446 missense probably damaging 1.00
R1440:Slc9a5 UTSW 8 105355153 missense possibly damaging 0.91
R1625:Slc9a5 UTSW 8 105368123 missense possibly damaging 0.88
R1737:Slc9a5 UTSW 8 105368134 missense probably damaging 1.00
R4169:Slc9a5 UTSW 8 105357400 missense possibly damaging 0.77
R4209:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4210:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4211:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4345:Slc9a5 UTSW 8 105349455 missense probably benign
R4665:Slc9a5 UTSW 8 105368128 missense probably damaging 1.00
R5058:Slc9a5 UTSW 8 105355858 missense probably benign 0.03
R5553:Slc9a5 UTSW 8 105357040 missense probably damaging 1.00
R5574:Slc9a5 UTSW 8 105364691 missense probably benign 0.12
R5631:Slc9a5 UTSW 8 105349509 missense possibly damaging 0.73
R5645:Slc9a5 UTSW 8 105357013 missense probably benign 0.00
R5856:Slc9a5 UTSW 8 105357165 missense possibly damaging 0.58
R5907:Slc9a5 UTSW 8 105357175 critical splice donor site probably null
R6481:Slc9a5 UTSW 8 105358393 nonsense probably null
R6799:Slc9a5 UTSW 8 105363968 missense possibly damaging 0.84
R6834:Slc9a5 UTSW 8 105364684 missense probably benign 0.00
R6938:Slc9a5 UTSW 8 105353432 missense probably damaging 1.00
R7064:Slc9a5 UTSW 8 105349446 missense possibly damaging 0.91
R7095:Slc9a5 UTSW 8 105357636 missense probably benign 0.16
R7152:Slc9a5 UTSW 8 105368393 missense probably benign 0.03
R7303:Slc9a5 UTSW 8 105356713 missense probably damaging 0.99
R7508:Slc9a5 UTSW 8 105363253 splice site probably null
R7583:Slc9a5 UTSW 8 105363272 missense possibly damaging 0.62
R7895:Slc9a5 UTSW 8 105363366 missense probably damaging 1.00
R8077:Slc9a5 UTSW 8 105359380 missense probably damaging 1.00
R8751:Slc9a5 UTSW 8 105359349 missense probably damaging 1.00
X0058:Slc9a5 UTSW 8 105355305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGGTGAACTCTGGAAAC -3'
(R):5'- AAGCATCTCCTCGAGCTGAG -3'

Sequencing Primer
(F):5'- TGGAAACGCCAGGCTGG -3'
(R):5'- CATCTCCTCGAGCTGAGTTGAG -3'
Posted On2020-07-13