Incidental Mutation 'R8217:B3gat1'
ID636425
Institutional Source Beutler Lab
Gene Symbol B3gat1
Ensembl Gene ENSMUSG00000045994
Gene Namebeta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
SynonymsGlcAT-P, 0710007K08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_029792; MGI: 1924148

Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location26733728-26763101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26756869 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 265 (A265T)
Ref Sequence ENSEMBL: ENSMUSP00000110924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115269] [ENSMUST00000159799] [ENSMUST00000160899] [ENSMUST00000161115] [ENSMUST00000161431]
Predicted Effect probably damaging
Transcript: ENSMUST00000115269
AA Change: A265T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110924
Gene: ENSMUSG00000045994
AA Change: A265T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 329 6.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159527
AA Change: A195T
SMART Domains Protein: ENSMUSP00000125401
Gene: ENSMUSG00000045994
AA Change: A195T

DomainStartEndE-ValueType
Pfam:Glyco_transf_43 48 259 2.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159799
AA Change: A265T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124438
Gene: ENSMUSG00000045994
AA Change: A265T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 329 6.6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160899
AA Change: A265T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124067
Gene: ENSMUSG00000045994
AA Change: A265T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 328 1.7e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161115
AA Change: A252T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125700
Gene: ENSMUSG00000045994
AA Change: A252T

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_43 105 316 3.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161431
SMART Domains Protein: ENSMUSP00000124752
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_43 105 202 1.9e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the glucuronyltransferase gene family. These enzymes exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product functions as the key enzyme in a glucuronyl transfer reaction during the biosynthesis of the carbohydrate epitope HNK-1 (human natural killer-1, also known as CD57 and LEU7). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced long term potentiation and impaired spatial learning. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in B3gat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:B3gat1 APN 9 26755910 missense possibly damaging 0.88
IGL01357:B3gat1 APN 9 26756987 missense probably damaging 1.00
IGL02140:B3gat1 APN 9 26757747 missense possibly damaging 0.63
R0098:B3gat1 UTSW 9 26756941 missense probably damaging 1.00
R0098:B3gat1 UTSW 9 26756941 missense probably damaging 1.00
R0234:B3gat1 UTSW 9 26756081 missense probably damaging 0.99
R0234:B3gat1 UTSW 9 26756081 missense probably damaging 0.99
R0944:B3gat1 UTSW 9 26756941 missense probably damaging 1.00
R1608:B3gat1 UTSW 9 26751816 missense probably damaging 1.00
R1957:B3gat1 UTSW 9 26755952 missense possibly damaging 0.86
R3401:B3gat1 UTSW 9 26755853 missense probably damaging 1.00
R3956:B3gat1 UTSW 9 26757028 missense possibly damaging 0.49
R4669:B3gat1 UTSW 9 26751756 missense probably benign 0.37
R4803:B3gat1 UTSW 9 26755690 missense probably benign 0.01
R4942:B3gat1 UTSW 9 26755598 missense probably benign 0.00
R6818:B3gat1 UTSW 9 26751702 start gained probably benign
R7912:B3gat1 UTSW 9 26755586 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTATTAAGTGACCCACCTCCTG -3'
(R):5'- AGTCCTGAAGAGGGTCTTACC -3'

Sequencing Primer
(F):5'- CAGGTAGTGTTTTCATCCTAGATTC -3'
(R):5'- CCTGAAGAGGGTCTTACCTTGGTAC -3'
Posted On2020-07-13