Incidental Mutation 'R8217:Ttc21a'
ID636429
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Nametetratricopeptide repeat domain 21A
SynonymsThm2, 4921538N17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R8217 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119937606-119967793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119954628 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 592 (I592T)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
Predicted Effect probably benign
Transcript: ENSMUST00000035100
AA Change: I592T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: I592T

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119965819 missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119958116 missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119956923 missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119950835 nonsense probably null
IGL02252:Ttc21a APN 9 119956928 missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119958281 missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119942576 missense probably benign 0.01
IGL03155:Ttc21a APN 9 119943976 critical splice donor site probably null
IGL03323:Ttc21a APN 9 119940536 intron probably benign
R0054:Ttc21a UTSW 9 119943940 missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119954562 missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119939154 intron probably benign
R0541:Ttc21a UTSW 9 119956826 intron probably benign
R0545:Ttc21a UTSW 9 119958799 missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119961842 missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119954652 missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119954261 missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119942641 missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119956947 missense probably benign 0.00
R1631:Ttc21a UTSW 9 119954162 splice site probably null
R1905:Ttc21a UTSW 9 119966757 missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119964295 missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119940461 missense probably benign 0.01
R2265:Ttc21a UTSW 9 119959008 missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119966123 missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119941265 missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119952254 missense probably benign 0.02
R3792:Ttc21a UTSW 9 119954165 missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119950816 intron probably benign
R4232:Ttc21a UTSW 9 119942618 missense probably benign 0.00
R4492:Ttc21a UTSW 9 119941280 missense probably benign 0.00
R4498:Ttc21a UTSW 9 119958819 missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119961762 missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119959037 missense probably benign
R4960:Ttc21a UTSW 9 119945001 missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119944961 missense probably benign 0.00
R5015:Ttc21a UTSW 9 119966129 missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119942665 missense probably benign 0.01
R5117:Ttc21a UTSW 9 119966565 missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119952212 missense probably benign 0.04
R5452:Ttc21a UTSW 9 119950971 missense probably benign 0.00
R5733:Ttc21a UTSW 9 119941261 missense probably benign
R5734:Ttc21a UTSW 9 119966666 missense probably benign
R5869:Ttc21a UTSW 9 119958792 missense probably benign 0.03
R6214:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119943962 missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119941202 missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119942635 missense probably benign 0.24
R7009:Ttc21a UTSW 9 119958073 nonsense probably null
R7060:Ttc21a UTSW 9 119966676 missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119945541 missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119959051 missense probably benign 0.01
R7438:Ttc21a UTSW 9 119945539 missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119958069 missense probably benign 0.12
R7703:Ttc21a UTSW 9 119959029 missense probably benign 0.14
R8076:Ttc21a UTSW 9 119966326 missense probably benign 0.01
RF004:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119942680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGGCATACGCGTTCCCC -3'
(R):5'- CTCACTCTGAGGCTAAAACTCTCAG -3'

Sequencing Primer
(F):5'- AGACCCTCTGCTAACCGG -3'
(R):5'- AGGATTTGAACTCTGGCCCTCAG -3'
Posted On2020-07-13