Incidental Mutation 'R8217:Olfr325'
ID636430
Institutional Source Beutler Lab
Gene Symbol Olfr325
Ensembl Gene ENSMUSG00000060765
Gene Nameolfactory receptor 325
SynonymsMOR275-5, MOR275-11_p, GA_x6K02T2NKPP-844642-843680
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58577730-58582365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58580966 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 41 (M41L)
Ref Sequence ENSEMBL: ENSMUSP00000145386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169428] [ENSMUST00000203418]
Predicted Effect probably benign
Transcript: ENSMUST00000169428
AA Change: M41L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131257
Gene: ENSMUSG00000060765
AA Change: M41L

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 290 1.4e-6 PFAM
Pfam:7tm_1 45 294 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203418
AA Change: M41L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145386
Gene: ENSMUSG00000060765
AA Change: M41L

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 7.6e-14 PFAM
Pfam:7TM_GPCR_Srsx 36 130 1.1e-4 PFAM
Pfam:7tm_1 45 130 2.6e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
Lrrc72 A T 12: 36,208,677 D60E probably damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Olfr325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr325 APN 11 58581810 missense probably benign
IGL01922:Olfr325 APN 11 58581073 missense probably benign 0.01
IGL02440:Olfr325 APN 11 58581209 missense probably damaging 1.00
IGL02456:Olfr325 APN 11 58581198 missense possibly damaging 0.48
IGL03088:Olfr325 APN 11 58581827 utr 3 prime probably benign
IGL03328:Olfr325 APN 11 58581713 missense probably damaging 1.00
R0604:Olfr325 UTSW 11 58581348 missense probably damaging 0.99
R1698:Olfr325 UTSW 11 58581251 missense probably damaging 1.00
R2473:Olfr325 UTSW 11 58581575 missense probably damaging 1.00
R2888:Olfr325 UTSW 11 58581162 missense possibly damaging 0.96
R4133:Olfr325 UTSW 11 58581075 missense probably damaging 0.97
R4710:Olfr325 UTSW 11 58581722 missense probably damaging 1.00
R4715:Olfr325 UTSW 11 58581429 missense probably damaging 1.00
R4898:Olfr325 UTSW 11 58581720 missense probably damaging 1.00
R4939:Olfr325 UTSW 11 58581211 missense probably damaging 1.00
R4977:Olfr325 UTSW 11 58581629 missense possibly damaging 0.57
R5389:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R5393:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R6137:Olfr325 UTSW 11 58581068 missense probably benign
R6302:Olfr325 UTSW 11 58581638 missense probably benign
R6655:Olfr325 UTSW 11 58581210 missense probably damaging 1.00
R6927:Olfr325 UTSW 11 58581665 missense possibly damaging 0.81
R7451:Olfr325 UTSW 11 58581690 missense probably damaging 1.00
R7494:Olfr325 UTSW 11 58581212 missense probably damaging 0.97
R7626:Olfr325 UTSW 11 58581173 missense probably damaging 0.97
R7724:Olfr325 UTSW 11 58581382 missense probably benign 0.01
R7874:Olfr325 UTSW 11 58581747 missense possibly damaging 0.93
R8252:Olfr325 UTSW 11 58581132 missense probably damaging 1.00
Z1177:Olfr325 UTSW 11 58581311 missense probably damaging 1.00
Z1186:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1186:Olfr325 UTSW 11 58580931 missense probably benign
Z1186:Olfr325 UTSW 11 58581002 missense probably benign
Z1186:Olfr325 UTSW 11 58581296 missense probably benign
Z1186:Olfr325 UTSW 11 58581657 missense probably benign
Z1187:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1187:Olfr325 UTSW 11 58580931 missense probably benign
Z1187:Olfr325 UTSW 11 58581002 missense probably benign
Z1187:Olfr325 UTSW 11 58581296 missense probably benign
Z1187:Olfr325 UTSW 11 58581657 missense probably benign
Z1188:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1188:Olfr325 UTSW 11 58580931 missense probably benign
Z1188:Olfr325 UTSW 11 58581002 missense probably benign
Z1188:Olfr325 UTSW 11 58581296 missense probably benign
Z1188:Olfr325 UTSW 11 58581657 missense probably benign
Z1189:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1189:Olfr325 UTSW 11 58580931 missense probably benign
Z1189:Olfr325 UTSW 11 58581296 missense probably benign
Z1189:Olfr325 UTSW 11 58581657 missense probably benign
Z1190:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1190:Olfr325 UTSW 11 58580931 missense probably benign
Z1190:Olfr325 UTSW 11 58581002 missense probably benign
Z1190:Olfr325 UTSW 11 58581296 missense probably benign
Z1190:Olfr325 UTSW 11 58581657 missense probably benign
Z1191:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1191:Olfr325 UTSW 11 58580931 missense probably benign
Z1191:Olfr325 UTSW 11 58581002 missense probably benign
Z1191:Olfr325 UTSW 11 58581296 missense probably benign
Z1191:Olfr325 UTSW 11 58581657 missense probably benign
Z1192:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1192:Olfr325 UTSW 11 58580931 missense probably benign
Z1192:Olfr325 UTSW 11 58581296 missense probably benign
Z1192:Olfr325 UTSW 11 58581657 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAGGCCCAGAGAACTTAG -3'
(R):5'- AGCTGAGATCTTGTGGCTCC -3'

Sequencing Primer
(F):5'- ACTTAGCACAGGCAGGTTG -3'
(R):5'- AGATCTTGTGGCTCCCCAGG -3'
Posted On2020-07-13