Incidental Mutation 'R8217:Lrrc72'
ID636431
Institutional Source Beutler Lab
Gene Symbol Lrrc72
Ensembl Gene ENSMUSG00000020545
Gene Nameleucine rich repeat containing 72
Synonyms1700108M19Rik, 4933421E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8217 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location36208345-36253398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36208677 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 60 (D60E)
Ref Sequence ENSEMBL: ENSMUSP00000020853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020853] [ENSMUST00000122115]
Predicted Effect probably damaging
Transcript: ENSMUST00000020853
AA Change: D60E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000122115
SMART Domains Protein: ENSMUSP00000113517
Gene: ENSMUSG00000020545

DomainStartEndE-ValueType
Pfam:LRR_9 1 69 6.6e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp T C 6: 125,060,958 L406P probably damaging Het
Aph1b T C 9: 66,779,272 K239E possibly damaging Het
Atp13a4 C A 16: 29,403,801 V1102F Het
B3gat1 G A 9: 26,756,869 A265T probably damaging Het
Bod1l T C 5: 41,831,507 E419G probably damaging Het
Ccdc142 T C 6: 83,103,216 L380P probably damaging Het
Cd55b CTTTT CTTTTT 1: 130,419,600 probably null Het
Cfi A C 3: 129,855,001 N178T possibly damaging Het
Col5a1 T A 2: 27,922,123 D72E unknown Het
Cspg4 T A 9: 56,890,353 V1367D possibly damaging Het
D5Ertd579e A C 5: 36,614,058 S998A probably benign Het
Ehf T C 2: 103,279,631 E77G possibly damaging Het
Erap1 T C 13: 74,672,818 I662T probably benign Het
F11r GGTGTG GGTGTGTG 1: 171,463,088 probably null Het
Klhl8 A G 5: 103,867,600 V486A possibly damaging Het
March5 C T 19: 37,207,811 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mtmr12 T C 15: 12,259,640 I365T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nod2 A C 8: 88,664,157 D364A probably benign Het
Numa1 T A 7: 101,992,669 M108K possibly damaging Het
Nutm2 G T 13: 50,469,723 R152L probably benign Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr299 A G 7: 86,466,182 Y257C probably damaging Het
Olfr325 A T 11: 58,580,966 M41L probably benign Het
Pak1ip1 T A 13: 41,012,650 S350R probably benign Het
Pcdha3 T C 18: 36,946,921 F239L probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkm C T 9: 59,678,809 T524I possibly damaging Het
Plekhg2 T A 7: 28,368,292 Q245L probably null Het
Pola2 T A 19: 5,963,827 K26N possibly damaging Het
Prune2 G T 19: 17,120,116 A995S probably benign Het
Rap2b C A 3: 61,365,130 T25K possibly damaging Het
Scrib A G 15: 76,067,155 S165P probably damaging Het
Sdk1 A T 5: 142,211,958 H2122L possibly damaging Het
Sec24b A T 3: 130,040,950 F200I possibly damaging Het
Sh3rf1 T C 8: 61,329,930 V226A possibly damaging Het
Sik1 T A 17: 31,851,312 H141L probably damaging Het
Slc9a5 A T 8: 105,363,324 E638V probably damaging Het
Slco1a5 A G 6: 142,275,476 C15R probably benign Het
Slit1 C T 19: 41,624,520 D854N possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tec A T 5: 72,764,259 M372K probably benign Het
Tlr2 A G 3: 83,838,066 F237L probably benign Het
Trio A T 15: 27,818,969 L1597Q probably damaging Het
Trpa1 A T 1: 14,887,023 M723K probably damaging Het
Ttc21a T C 9: 119,954,628 I592T probably benign Het
Vmn2r94 T C 17: 18,243,724 E768G probably damaging Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zpld1 A G 16: 55,226,932 probably null Het
Other mutations in Lrrc72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Lrrc72 APN 12 36221508 missense probably benign 0.01
IGL01573:Lrrc72 APN 12 36212562 splice site probably null
R1905:Lrrc72 UTSW 12 36208662 splice site probably null
R3754:Lrrc72 UTSW 12 36212568 missense probably benign 0.04
R4429:Lrrc72 UTSW 12 36208624 missense probably damaging 1.00
R6263:Lrrc72 UTSW 12 36208604 nonsense probably null
R6895:Lrrc72 UTSW 12 36209718 missense probably damaging 0.99
R7263:Lrrc72 UTSW 12 36208612 missense probably damaging 1.00
R7410:Lrrc72 UTSW 12 36222804 missense probably damaging 1.00
R7452:Lrrc72 UTSW 12 36212693 missense probably benign 0.11
R8728:Lrrc72 UTSW 12 36208657 missense probably benign 0.03
V8831:Lrrc72 UTSW 12 36208657 missense possibly damaging 0.65
Z1177:Lrrc72 UTSW 12 36247693 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGTTCTAACGAGTGAGCGAAC -3'
(R):5'- GCTTTAGGTGTGCTCCAGAG -3'

Sequencing Primer
(F):5'- AACAGCACCGGGAGTTTC -3'
(R):5'- TGTGCTCCAGAGGTAAATAAAACAC -3'
Posted On2020-07-13