Incidental Mutation 'R8218:Slc40a1'
ID636449
Institutional Source Beutler Lab
Gene Symbol Slc40a1
Ensembl Gene ENSMUSG00000025993
Gene Namesolute carrier family 40 (iron-regulated transporter), member 1
SynonymsDusg, metal transporting protein 1, Ol5, ferroportin1, IREG1, Slc11a3, FPN1, Pcm, MTP1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8218 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location45908068-45926523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45910969 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 441 (V441G)
Ref Sequence ENSEMBL: ENSMUSP00000027137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027137]
Predicted Effect probably benign
Transcript: ENSMUST00000027137
AA Change: V441G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027137
Gene: ENSMUSG00000025993
AA Change: V441G

DomainStartEndE-ValueType
Pfam:FPN1 22 530 5e-194 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality before embryo turning. Mice heterozygous for a targeted mutation display decreased thermal response latency. Mice heterozygous for an ENU induced mutation display abnormal iron homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik G A 15: 84,955,467 H191Y probably damaging Het
5730480H06Rik T A 5: 48,379,427 L155* probably null Het
Ackr4 T C 9: 104,099,211 N179S probably benign Het
Acp5 T C 9: 22,129,606 Y107C probably damaging Het
Aff4 A T 11: 53,398,257 H411L probably damaging Het
Atp5f1 A G 3: 105,959,186 M1T probably null Het
Atp8b5 G A 4: 43,372,728 probably null Het
C1qtnf2 A G 11: 43,490,948 T166A possibly damaging Het
Dctn2 A G 10: 127,276,529 D170G probably damaging Het
Dennd3 T A 15: 73,512,773 S10T probably benign Het
Ehbp1 T C 11: 22,096,096 Y551C possibly damaging Het
Eif4g2 A T 7: 111,074,432 D743E possibly damaging Het
Esr1 G A 10: 4,746,808 probably null Het
Exo1 A T 1: 175,900,914 I515L probably benign Het
Fam71f2 T C 6: 29,286,073 I177T probably damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Gcn1l1 G A 5: 115,581,529 S361N probably benign Het
Gm6337 C T 14: 6,050,613 probably null Het
Grk4 T A 5: 34,669,196 S47T probably benign Het
Gstp2 C A 19: 4,041,668 M20I probably benign Het
Harbi1 T C 2: 91,712,892 F233L probably benign Het
Iqch C T 9: 63,482,633 V755I possibly damaging Het
Iws1 T C 18: 32,093,635 F756L probably benign Het
Kcnh6 T G 11: 106,017,374 V272G possibly damaging Het
Kcnj10 C T 1: 172,368,972 R18C probably damaging Het
Kmt2c A C 5: 25,283,106 S4670A probably damaging Het
Krt80 T G 15: 101,370,003 M18L probably benign Het
Lbx1 A G 19: 45,234,920 V103A probably benign Het
March8 A T 6: 116,338,098 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Muc16 T A 9: 18,637,019 T5993S possibly damaging Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr1122 C T 2: 87,388,578 T291I probably damaging Het
Olfr346 A G 2: 36,688,673 T224A probably benign Het
Olfr99 A G 17: 37,279,820 V200A probably benign Het
Pbxip1 A G 3: 89,445,595 I183V probably benign Het
Pcdh20 T A 14: 88,468,611 I418F probably damaging Het
Pclo T C 5: 14,675,663 F1512L unknown Het
Phf2 G T 13: 48,804,628 T970K unknown Het
Pidd1 A G 7: 141,439,653 V698A probably damaging Het
Pik3ca T A 3: 32,437,847 V198D possibly damaging Het
Pip5k1c T A 10: 81,306,416 D153E probably damaging Het
Ppfia2 A G 10: 106,863,375 D795G probably benign Het
Pramef8 A T 4: 143,419,136 I392F probably benign Het
Prkar2a C A 9: 108,719,249 A131D possibly damaging Het
Pter A G 2: 12,980,555 D232G probably damaging Het
Qser1 C T 2: 104,762,923 R1583Q probably damaging Het
Rasal2 A C 1: 157,157,381 V932G probably damaging Het
Rasgrf2 G A 13: 91,982,677 A154V Het
Rbm4 A G 19: 4,787,416 Y347H probably damaging Het
Rfxank C A 8: 70,131,435 probably null Het
Robo1 C G 16: 72,989,790 R897G possibly damaging Het
Sash1 G A 10: 8,751,236 T364I probably damaging Het
Skint6 T A 4: 112,839,274 probably null Het
Slc22a4 T A 11: 53,986,581 M495L probably benign Het
Slc39a8 G A 3: 135,857,564 V212I probably benign Het
Slc7a11 A T 3: 50,424,052 Y246N probably damaging Het
Spata9 T C 13: 75,977,773 V125A probably benign Het
Svopl T A 6: 38,014,806 M380L probably benign Het
Sycp2l T C 13: 41,118,068 Y23H probably damaging Het
Syt11 A T 3: 88,762,120 V155E probably benign Het
Syt5 T C 7: 4,542,823 Y147C probably damaging Het
Thg1l T C 11: 45,955,450 T6A probably benign Het
Tlr2 A G 3: 83,838,239 L179P probably damaging Het
Tsn A T 1: 118,305,254 Y107N probably damaging Het
Tspan32 A T 7: 143,011,095 Y114F probably benign Het
Tube1 A C 10: 39,147,379 S341R possibly damaging Het
Ubn2 T A 6: 38,489,279 V516D probably benign Het
Vmn1r21 G T 6: 57,843,925 T178K noncoding transcript Het
Vmn2r108 A G 17: 20,463,203 Y580H probably damaging Het
Wdr75 T A 1: 45,818,182 F546L probably damaging Het
Yy1 A G 12: 108,793,693 D94G probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfy2 T C Y: 2,133,421 T9A unknown Het
Other mutations in Slc40a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Slc40a1 APN 1 45909492 missense probably benign 0.19
IGL01576:Slc40a1 APN 1 45909597 missense probably damaging 1.00
IGL02113:Slc40a1 APN 1 45910894 missense probably benign 0.33
IGL02116:Slc40a1 APN 1 45911528 missense probably benign 0.01
IGL02220:Slc40a1 APN 1 45911335 missense probably damaging 1.00
IGL02537:Slc40a1 APN 1 45911393 missense probably benign 0.01
IGL02574:Slc40a1 APN 1 45912374 missense possibly damaging 0.77
IGL02673:Slc40a1 APN 1 45918416 missense possibly damaging 0.82
IGL02794:Slc40a1 APN 1 45909508 nonsense probably null
R0376:Slc40a1 UTSW 1 45912491 splice site probably benign
R0417:Slc40a1 UTSW 1 45911374 missense possibly damaging 0.50
R1608:Slc40a1 UTSW 1 45911297 missense probably damaging 0.96
R1723:Slc40a1 UTSW 1 45924761 missense probably damaging 1.00
R1892:Slc40a1 UTSW 1 45911142 nonsense probably null
R2092:Slc40a1 UTSW 1 45909454 missense probably benign
R2303:Slc40a1 UTSW 1 45910884 splice site probably benign
R2365:Slc40a1 UTSW 1 45924713 splice site probably null
R3718:Slc40a1 UTSW 1 45910991 missense probably benign
R4689:Slc40a1 UTSW 1 45912313 missense probably benign 0.00
R4994:Slc40a1 UTSW 1 45909664 missense probably damaging 1.00
R5103:Slc40a1 UTSW 1 45918995 nonsense probably null
R5151:Slc40a1 UTSW 1 45911356 missense possibly damaging 0.84
R5364:Slc40a1 UTSW 1 45925223 missense probably damaging 0.96
R5404:Slc40a1 UTSW 1 45912328 missense probably damaging 1.00
R5531:Slc40a1 UTSW 1 45912338 missense probably damaging 1.00
R5841:Slc40a1 UTSW 1 45912349 missense probably damaging 1.00
R6440:Slc40a1 UTSW 1 45925262 start codon destroyed probably null 0.94
R6455:Slc40a1 UTSW 1 45918947 missense probably damaging 0.99
R6975:Slc40a1 UTSW 1 45909492 missense probably benign 0.19
R7085:Slc40a1 UTSW 1 45911528 missense probably benign
R7130:Slc40a1 UTSW 1 45921224 missense probably damaging 1.00
R7502:Slc40a1 UTSW 1 45918974 missense probably damaging 1.00
R7755:Slc40a1 UTSW 1 45911306 missense probably damaging 0.99
R8085:Slc40a1 UTSW 1 45918368 missense probably damaging 1.00
R8308:Slc40a1 UTSW 1 45911020 missense probably benign 0.02
R8333:Slc40a1 UTSW 1 45911279 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTTTCTTCCAACACACCACAG -3'
(R):5'- ATTCTCAGGACTAGCCCAGC -3'

Sequencing Primer
(F):5'- TGGGTTTTGCCTAAATTAACATCTG -3'
(R):5'- AGGACTAGCCCAGCTTTCCTG -3'
Posted On2020-07-13