Incidental Mutation 'R8218:Slc7a11'
ID 636461
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms sut, System x, x, 9930009M05Rik, xCT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8218 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 49892526-50443614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 50424052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 246 (Y246N)
Ref Sequence ENSEMBL: ENSMUSP00000029297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
AlphaFold Q9WTR6
Predicted Effect probably damaging
Transcript: ENSMUST00000029297
AA Change: Y246N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: Y246N

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194462
AA Change: Y246N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: Y246N

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Meta Mutation Damage Score 0.9707 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik G A 15: 84,955,467 H191Y probably damaging Het
5730480H06Rik T A 5: 48,379,427 L155* probably null Het
Ackr4 T C 9: 104,099,211 N179S probably benign Het
Acp5 T C 9: 22,129,606 Y107C probably damaging Het
Aff4 A T 11: 53,398,257 H411L probably damaging Het
Atp5f1 A G 3: 105,959,186 M1T probably null Het
Atp8b5 G A 4: 43,372,728 probably null Het
C1qtnf2 A G 11: 43,490,948 T166A possibly damaging Het
Dctn2 A G 10: 127,276,529 D170G probably damaging Het
Dennd3 T A 15: 73,512,773 S10T probably benign Het
Ehbp1 T C 11: 22,096,096 Y551C possibly damaging Het
Eif4g2 A T 7: 111,074,432 D743E possibly damaging Het
Esr1 G A 10: 4,746,808 probably null Het
Exo1 A T 1: 175,900,914 I515L probably benign Het
Fam71f2 T C 6: 29,286,073 I177T probably damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Gcn1l1 G A 5: 115,581,529 S361N probably benign Het
Gm6337 C T 14: 6,050,613 probably null Het
Grk4 T A 5: 34,669,196 S47T probably benign Het
Gstp2 C A 19: 4,041,668 M20I probably benign Het
Harbi1 T C 2: 91,712,892 F233L probably benign Het
Iqch C T 9: 63,482,633 V755I possibly damaging Het
Iws1 T C 18: 32,093,635 F756L probably benign Het
Kcnh6 T G 11: 106,017,374 V272G possibly damaging Het
Kcnj10 C T 1: 172,368,972 R18C probably damaging Het
Kmt2c A C 5: 25,283,106 S4670A probably damaging Het
Krt80 T G 15: 101,370,003 M18L probably benign Het
Lbx1 A G 19: 45,234,920 V103A probably benign Het
March8 A T 6: 116,338,098 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Muc16 T A 9: 18,637,019 T5993S possibly damaging Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr1122 C T 2: 87,388,578 T291I probably damaging Het
Olfr346 A G 2: 36,688,673 T224A probably benign Het
Olfr99 A G 17: 37,279,820 V200A probably benign Het
Pbxip1 A G 3: 89,445,595 I183V probably benign Het
Pcdh20 T A 14: 88,468,611 I418F probably damaging Het
Pclo T C 5: 14,675,663 F1512L unknown Het
Phf2 G T 13: 48,804,628 T970K unknown Het
Pidd1 A G 7: 141,439,653 V698A probably damaging Het
Pik3ca T A 3: 32,437,847 V198D possibly damaging Het
Pip5k1c T A 10: 81,306,416 D153E probably damaging Het
Ppfia2 A G 10: 106,863,375 D795G probably benign Het
Pramef8 A T 4: 143,419,136 I392F probably benign Het
Prkar2a C A 9: 108,719,249 A131D possibly damaging Het
Pter A G 2: 12,980,555 D232G probably damaging Het
Qser1 C T 2: 104,762,923 R1583Q probably damaging Het
Rasal2 A C 1: 157,157,381 V932G probably damaging Het
Rasgrf2 G A 13: 91,982,677 A154V Het
Rbm4 A G 19: 4,787,416 Y347H probably damaging Het
Rfxank C A 8: 70,131,435 probably null Het
Robo1 C G 16: 72,989,790 R897G possibly damaging Het
Sash1 G A 10: 8,751,236 T364I probably damaging Het
Skint6 T A 4: 112,839,274 probably null Het
Slc22a4 T A 11: 53,986,581 M495L probably benign Het
Slc39a8 G A 3: 135,857,564 V212I probably benign Het
Slc40a1 A C 1: 45,910,969 V441G probably benign Het
Spata9 T C 13: 75,977,773 V125A probably benign Het
Svopl T A 6: 38,014,806 M380L probably benign Het
Sycp2l T C 13: 41,118,068 Y23H probably damaging Het
Syt11 A T 3: 88,762,120 V155E probably benign Het
Syt5 T C 7: 4,542,823 Y147C probably damaging Het
Thg1l T C 11: 45,955,450 T6A probably benign Het
Tlr2 A G 3: 83,838,239 L179P probably damaging Het
Tsn A T 1: 118,305,254 Y107N probably damaging Het
Tspan32 A T 7: 143,011,095 Y114F probably benign Het
Tube1 A C 10: 39,147,379 S341R possibly damaging Het
Ubn2 T A 6: 38,489,279 V516D probably benign Het
Vmn1r21 G T 6: 57,843,925 T178K noncoding transcript Het
Vmn2r108 A G 17: 20,463,203 Y580H probably damaging Het
Wdr75 T A 1: 45,818,182 F546L probably damaging Het
Yy1 A G 12: 108,793,693 D94G probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfy2 T C Y: 2,133,421 T9A unknown Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50384051 missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2128:Slc7a11 UTSW 3 50384109 missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R4479:Slc7a11 UTSW 3 50417963 intron probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50438875 missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50417986 critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
R8857:Slc7a11 UTSW 3 50438856 missense probably damaging 1.00
R8967:Slc7a11 UTSW 3 50384115 missense probably benign 0.00
R9044:Slc7a11 UTSW 3 50379183 missense probably benign 0.20
R9104:Slc7a11 UTSW 3 50377633 missense probably benign 0.01
R9404:Slc7a11 UTSW 3 50381039 missense possibly damaging 0.64
R9500:Slc7a11 UTSW 3 50427752 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGCATTATGCTCTTTGGCAG -3'
(R):5'- GGCTCTCAACCAAGTATAGGG -3'

Sequencing Primer
(F):5'- AGGTCTTCATTTCTGAGAATTCTGTG -3'
(R):5'- CAGGGCAAACACATCACTT -3'
Posted On 2020-07-13