Mutagenetix > Incidental Mutation

Incidental Mutation 'R8218:Slc7a11'

636461

Institutional Source

Beutler Lab

Gene Symbol

Slc7a11

Ensembl Gene

ENSMUSG00000027737

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 11

Synonyms

sut, System x, x, 9930009M05Rik, xCT

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49892526-50443614 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50424052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 246 (Y246N)

Ref Sequence

ENSEMBL: ENSMUSP00000029297 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]

AlphaFold

Q9WTR6

Predicted Effect

probably damaging
Transcript: ENSMUST00000029297
AA Change: Y246N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: Y246N

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	44	469	3.3e-61	PFAM
Pfam:AA_permease	49	478	1.1e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000194462
AA Change: Y246N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: Y246N

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	44	469	1.1e-60	PFAM
Pfam:AA_permease	49	479	2e-32	PFAM

Meta Mutation Damage Score

0.9707

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	G	A	15: 84,955,467	H191Y	probably damaging	Het
5730480H06Rik	T	A	5: 48,379,427	L155*	probably null	Het
Ackr4	T	C	9: 104,099,211	N179S	probably benign	Het
Acp5	T	C	9: 22,129,606	Y107C	probably damaging	Het
Aff4	A	T	11: 53,398,257	H411L	probably damaging	Het
Atp5f1	A	G	3: 105,959,186	M1T	probably null	Het
Atp8b5	G	A	4: 43,372,728		probably null	Het
C1qtnf2	A	G	11: 43,490,948	T166A	possibly damaging	Het
Dctn2	A	G	10: 127,276,529	D170G	probably damaging	Het
Dennd3	T	A	15: 73,512,773	S10T	probably benign	Het
Ehbp1	T	C	11: 22,096,096	Y551C	possibly damaging	Het
Eif4g2	A	T	7: 111,074,432	D743E	possibly damaging	Het
Esr1	G	A	10: 4,746,808		probably null	Het
Exo1	A	T	1: 175,900,914	I515L	probably benign	Het
Fam71f2	T	C	6: 29,286,073	I177T	probably damaging	Het
Fam83h	C	T	15: 76,003,037	G817D	probably damaging	Het
Gcn1l1	G	A	5: 115,581,529	S361N	probably benign	Het
Gm6337	C	T	14: 6,050,613		probably null	Het
Grk4	T	A	5: 34,669,196	S47T	probably benign	Het
Gstp2	C	A	19: 4,041,668	M20I	probably benign	Het
Harbi1	T	C	2: 91,712,892	F233L	probably benign	Het
Iqch	C	T	9: 63,482,633	V755I	possibly damaging	Het
Iws1	T	C	18: 32,093,635	F756L	probably benign	Het
Kcnh6	T	G	11: 106,017,374	V272G	possibly damaging	Het
Kcnj10	C	T	1: 172,368,972	R18C	probably damaging	Het
Kmt2c	A	C	5: 25,283,106	S4670A	probably damaging	Het
Krt80	T	G	15: 101,370,003	M18L	probably benign	Het
Lbx1	A	G	19: 45,234,920	V103A	probably benign	Het
March8	A	T	6: 116,338,098		probably benign	Het
Mfsd7c	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Muc16	T	A	9: 18,637,019	T5993S	possibly damaging	Het
Olfr1048	C	T	2: 86,236,518	V106M	probably benign	Het
Olfr1122	C	T	2: 87,388,578	T291I	probably damaging	Het
Olfr346	A	G	2: 36,688,673	T224A	probably benign	Het
Olfr99	A	G	17: 37,279,820	V200A	probably benign	Het
Pbxip1	A	G	3: 89,445,595	I183V	probably benign	Het
Pcdh20	T	A	14: 88,468,611	I418F	probably damaging	Het
Pclo	T	C	5: 14,675,663	F1512L	unknown	Het
Phf2	G	T	13: 48,804,628	T970K	unknown	Het
Pidd1	A	G	7: 141,439,653	V698A	probably damaging	Het
Pik3ca	T	A	3: 32,437,847	V198D	possibly damaging	Het
Pip5k1c	T	A	10: 81,306,416	D153E	probably damaging	Het
Ppfia2	A	G	10: 106,863,375	D795G	probably benign	Het
Pramef8	A	T	4: 143,419,136	I392F	probably benign	Het
Prkar2a	C	A	9: 108,719,249	A131D	possibly damaging	Het
Pter	A	G	2: 12,980,555	D232G	probably damaging	Het
Qser1	C	T	2: 104,762,923	R1583Q	probably damaging	Het
Rasal2	A	C	1: 157,157,381	V932G	probably damaging	Het
Rasgrf2	G	A	13: 91,982,677	A154V		Het
Rbm4	A	G	19: 4,787,416	Y347H	probably damaging	Het
Rfxank	C	A	8: 70,131,435		probably null	Het
Robo1	C	G	16: 72,989,790	R897G	possibly damaging	Het
Sash1	G	A	10: 8,751,236	T364I	probably damaging	Het
Skint6	T	A	4: 112,839,274		probably null	Het
Slc22a4	T	A	11: 53,986,581	M495L	probably benign	Het
Slc39a8	G	A	3: 135,857,564	V212I	probably benign	Het
Slc40a1	A	C	1: 45,910,969	V441G	probably benign	Het
Spata9	T	C	13: 75,977,773	V125A	probably benign	Het
Svopl	T	A	6: 38,014,806	M380L	probably benign	Het
Sycp2l	T	C	13: 41,118,068	Y23H	probably damaging	Het
Syt11	A	T	3: 88,762,120	V155E	probably benign	Het
Syt5	T	C	7: 4,542,823	Y147C	probably damaging	Het
Thg1l	T	C	11: 45,955,450	T6A	probably benign	Het
Tlr2	A	G	3: 83,838,239	L179P	probably damaging	Het
Tsn	A	T	1: 118,305,254	Y107N	probably damaging	Het
Tspan32	A	T	7: 143,011,095	Y114F	probably benign	Het
Tube1	A	C	10: 39,147,379	S341R	possibly damaging	Het
Ubn2	T	A	6: 38,489,279	V516D	probably benign	Het
Vmn1r21	G	T	6: 57,843,925	T178K	noncoding transcript	Het
Vmn2r108	A	G	17: 20,463,203	Y580H	probably damaging	Het
Wdr75	T	A	1: 45,818,182	F546L	probably damaging	Het
Yy1	A	G	12: 108,793,693	D94G	probably benign	Het
Zfhx3	A	G	8: 108,950,717	T2800A	probably benign	Het
Zfy2	T	C	Y: 2,133,421	T9A	unknown	Het

Other mutations in Slc7a11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Slc7a11	APN	3	50427687	missense	probably benign	0.06
IGL00990:Slc7a11	APN	3	50379069	missense	probably damaging	1.00
IGL01755:Slc7a11	APN	3	50424067	missense	probably benign	0.39
IGL03105:Slc7a11	APN	3	50372339	missense	possibly damaging	0.67
IGL03141:Slc7a11	APN	3	50381885	missense	possibly damaging	0.66
R0468:Slc7a11	UTSW	3	50384051	missense	probably damaging	1.00
R0735:Slc7a11	UTSW	3	50424096	missense	probably benign	0.00
R1363:Slc7a11	UTSW	3	50424051	missense	probably damaging	1.00
R1466:Slc7a11	UTSW	3	50381073	splice site	probably null
R1466:Slc7a11	UTSW	3	50381073	splice site	probably null
R1554:Slc7a11	UTSW	3	50381896	missense	probably damaging	1.00
R1734:Slc7a11	UTSW	3	50372346	nonsense	probably null
R2128:Slc7a11	UTSW	3	50384109	missense	probably damaging	0.97
R2504:Slc7a11	UTSW	3	50377746	splice site	probably null
R3116:Slc7a11	UTSW	3	50384139	missense	probably benign	0.13
R3981:Slc7a11	UTSW	3	50427774	missense	probably benign
R4479:Slc7a11	UTSW	3	50417963	intron	probably benign
R5117:Slc7a11	UTSW	3	50379150	missense	probably damaging	0.99
R5586:Slc7a11	UTSW	3	50443083	missense	possibly damaging	0.95
R5621:Slc7a11	UTSW	3	50438875	missense	probably damaging	1.00
R5689:Slc7a11	UTSW	3	50372331	missense	probably benign	0.01
R5692:Slc7a11	UTSW	3	50372331	missense	probably benign	0.01
R5965:Slc7a11	UTSW	3	50379144	missense	probably benign	0.00
R6338:Slc7a11	UTSW	3	50384043	critical splice donor site	probably null
R7177:Slc7a11	UTSW	3	50443231	missense	probably benign	0.00
R7337:Slc7a11	UTSW	3	50442999	missense	possibly damaging	0.50
R7634:Slc7a11	UTSW	3	50424037	splice site	probably null
R7756:Slc7a11	UTSW	3	50372360	missense	probably benign
R7758:Slc7a11	UTSW	3	50372360	missense	probably benign
R7821:Slc7a11	UTSW	3	50381027	missense	probably damaging	1.00
R8112:Slc7a11	UTSW	3	50417991	missense	possibly damaging	0.92
R8255:Slc7a11	UTSW	3	50427728	missense	probably damaging	0.98
R8318:Slc7a11	UTSW	3	50417986	critical splice donor site	probably null
R8396:Slc7a11	UTSW	3	50384129	missense	possibly damaging	0.78
R8857:Slc7a11	UTSW	3	50438856	missense	probably damaging	1.00
R8967:Slc7a11	UTSW	3	50384115	missense	probably benign	0.00
R9044:Slc7a11	UTSW	3	50379183	missense	probably benign	0.20
R9104:Slc7a11	UTSW	3	50377633	missense	probably benign	0.01
R9404:Slc7a11	UTSW	3	50381039	missense	possibly damaging	0.64
R9500:Slc7a11	UTSW	3	50427752	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATGCATTATGCTCTTTGGCAG -3'
(R):5'- GGCTCTCAACCAAGTATAGGG -3'

Sequencing Primer
(F):5'- AGGTCTTCATTTCTGAGAATTCTGTG -3'
(R):5'- CAGGGCAAACACATCACTT -3'

Posted On

2020-07-13