Incidental Mutation 'R8218:Pbxip1'
ID636464
Institutional Source Beutler Lab
Gene Symbol Pbxip1
Ensembl Gene ENSMUSG00000042613
Gene Namepre B cell leukemia transcription factor interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8218 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89436706-89450952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89445595 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 183 (I183V)
Ref Sequence ENSEMBL: ENSMUSP00000040429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630]
Predicted Effect probably benign
Transcript: ENSMUST00000038942
AA Change: I183V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613
AA Change: I183V

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130858
AA Change: I190V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613
AA Change: I190V

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145753
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146630
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the PBX1 homeodomain protein, inhibiting its transcriptional activation potential by preventing its binding to DNA. The encoded protein, which is primarily cytosolic but can shuttle to the nucleus, also can interact with estrogen receptors alpha and beta and promote the proliferation of breast cancer, brain tumors, and lung cancer. Several transcript variants encoding different isoforms have been found for this gene. More variants exist, but their full-length natures have yet to be determined. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik G A 15: 84,955,467 H191Y probably damaging Het
5730480H06Rik T A 5: 48,379,427 L155* probably null Het
Ackr4 T C 9: 104,099,211 N179S probably benign Het
Acp5 T C 9: 22,129,606 Y107C probably damaging Het
Aff4 A T 11: 53,398,257 H411L probably damaging Het
Atp5f1 A G 3: 105,959,186 M1T probably null Het
Atp8b5 G A 4: 43,372,728 probably null Het
C1qtnf2 A G 11: 43,490,948 T166A possibly damaging Het
Dctn2 A G 10: 127,276,529 D170G probably damaging Het
Dennd3 T A 15: 73,512,773 S10T probably benign Het
Ehbp1 T C 11: 22,096,096 Y551C possibly damaging Het
Eif4g2 A T 7: 111,074,432 D743E possibly damaging Het
Esr1 G A 10: 4,746,808 probably null Het
Exo1 A T 1: 175,900,914 I515L probably benign Het
Fam71f2 T C 6: 29,286,073 I177T probably damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Gcn1l1 G A 5: 115,581,529 S361N probably benign Het
Gm6337 C T 14: 6,050,613 probably null Het
Grk4 T A 5: 34,669,196 S47T probably benign Het
Gstp2 C A 19: 4,041,668 M20I probably benign Het
Harbi1 T C 2: 91,712,892 F233L probably benign Het
Iqch C T 9: 63,482,633 V755I possibly damaging Het
Iws1 T C 18: 32,093,635 F756L probably benign Het
Kcnh6 T G 11: 106,017,374 V272G possibly damaging Het
Kcnj10 C T 1: 172,368,972 R18C probably damaging Het
Kmt2c A C 5: 25,283,106 S4670A probably damaging Het
Krt80 T G 15: 101,370,003 M18L probably benign Het
Lbx1 A G 19: 45,234,920 V103A probably benign Het
March8 A T 6: 116,338,098 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Muc16 T A 9: 18,637,019 T5993S possibly damaging Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr1122 C T 2: 87,388,578 T291I probably damaging Het
Olfr346 A G 2: 36,688,673 T224A probably benign Het
Olfr99 A G 17: 37,279,820 V200A probably benign Het
Pcdh20 T A 14: 88,468,611 I418F probably damaging Het
Pclo T C 5: 14,675,663 F1512L unknown Het
Phf2 G T 13: 48,804,628 T970K unknown Het
Pidd1 A G 7: 141,439,653 V698A probably damaging Het
Pik3ca T A 3: 32,437,847 V198D possibly damaging Het
Pip5k1c T A 10: 81,306,416 D153E probably damaging Het
Ppfia2 A G 10: 106,863,375 D795G probably benign Het
Pramef8 A T 4: 143,419,136 I392F probably benign Het
Prkar2a C A 9: 108,719,249 A131D possibly damaging Het
Pter A G 2: 12,980,555 D232G probably damaging Het
Qser1 C T 2: 104,762,923 R1583Q probably damaging Het
Rasal2 A C 1: 157,157,381 V932G probably damaging Het
Rasgrf2 G A 13: 91,982,677 A154V Het
Rbm4 A G 19: 4,787,416 Y347H probably damaging Het
Rfxank C A 8: 70,131,435 probably null Het
Robo1 C G 16: 72,989,790 R897G possibly damaging Het
Sash1 G A 10: 8,751,236 T364I probably damaging Het
Skint6 T A 4: 112,839,274 probably null Het
Slc22a4 T A 11: 53,986,581 M495L probably benign Het
Slc39a8 G A 3: 135,857,564 V212I probably benign Het
Slc40a1 A C 1: 45,910,969 V441G probably benign Het
Slc7a11 A T 3: 50,424,052 Y246N probably damaging Het
Spata9 T C 13: 75,977,773 V125A probably benign Het
Svopl T A 6: 38,014,806 M380L probably benign Het
Sycp2l T C 13: 41,118,068 Y23H probably damaging Het
Syt11 A T 3: 88,762,120 V155E probably benign Het
Syt5 T C 7: 4,542,823 Y147C probably damaging Het
Thg1l T C 11: 45,955,450 T6A probably benign Het
Tlr2 A G 3: 83,838,239 L179P probably damaging Het
Tsn A T 1: 118,305,254 Y107N probably damaging Het
Tspan32 A T 7: 143,011,095 Y114F probably benign Het
Tube1 A C 10: 39,147,379 S341R possibly damaging Het
Ubn2 T A 6: 38,489,279 V516D probably benign Het
Vmn1r21 G T 6: 57,843,925 T178K noncoding transcript Het
Vmn2r108 A G 17: 20,463,203 Y580H probably damaging Het
Wdr75 T A 1: 45,818,182 F546L probably damaging Het
Yy1 A G 12: 108,793,693 D94G probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfy2 T C Y: 2,133,421 T9A unknown Het
Other mutations in Pbxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Pbxip1 APN 3 89443590 splice site probably benign
IGL02612:Pbxip1 APN 3 89443681 missense probably damaging 1.00
IGL02718:Pbxip1 APN 3 89448004 missense probably damaging 1.00
R0538:Pbxip1 UTSW 3 89447619 missense possibly damaging 0.79
R0549:Pbxip1 UTSW 3 89443592 splice site probably benign
R1460:Pbxip1 UTSW 3 89445614 missense probably damaging 1.00
R1931:Pbxip1 UTSW 3 89447677 splice site probably null
R1966:Pbxip1 UTSW 3 89445488 missense probably damaging 1.00
R2008:Pbxip1 UTSW 3 89448713 missense probably benign 0.20
R3435:Pbxip1 UTSW 3 89447236 missense probably damaging 0.99
R4504:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
R4591:Pbxip1 UTSW 3 89446160 missense probably benign 0.33
R5491:Pbxip1 UTSW 3 89443159 missense probably benign 0.09
R6051:Pbxip1 UTSW 3 89443170 missense probably benign 0.08
R6620:Pbxip1 UTSW 3 89447826 missense probably benign 0.12
R7203:Pbxip1 UTSW 3 89447428 missense possibly damaging 0.68
R7259:Pbxip1 UTSW 3 89445633 missense probably benign
R7604:Pbxip1 UTSW 3 89445595 missense probably benign 0.01
R7687:Pbxip1 UTSW 3 89448199 missense probably damaging 1.00
R7710:Pbxip1 UTSW 3 89448101 missense probably damaging 1.00
R7980:Pbxip1 UTSW 3 89446341 missense probably benign 0.44
R8754:Pbxip1 UTSW 3 89447928 missense probably damaging 1.00
R8923:Pbxip1 UTSW 3 89445614 missense possibly damaging 0.78
R8951:Pbxip1 UTSW 3 89445557 missense probably benign 0.05
X0012:Pbxip1 UTSW 3 89445523 missense possibly damaging 0.91
X0012:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
Z1177:Pbxip1 UTSW 3 89447220 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTAGTACGCAGCTTGAGTGG -3'
(R):5'- TGAAGACAGTCTGGTGAGGC -3'

Sequencing Primer
(F):5'- CAGCTTGAGTGGGCAGTC -3'
(R):5'- ACAGTCTGGTGAGGCCTCAG -3'
Posted On2020-07-13