Incidental Mutation 'R0725:Dock7'
ID63648
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission 038907-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0725 (G1)
Quality Score162
Status Validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98945291 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1891 (D1891G)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650] [ENSMUST00000205652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030286
AA Change: D1921G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: D1921G

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075836
AA Change: D1893G
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: D1893G

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124040
Predicted Effect probably benign
Transcript: ENSMUST00000124466
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: D1923G
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: D1923G

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205484
Predicted Effect probably damaging
Transcript: ENSMUST00000205650
AA Change: D1891G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000205652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206128
Meta Mutation Damage Score 0.7614 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,027,143 D131E probably damaging Het
Asph C T 4: 9,542,275 D305N probably damaging Het
Atp13a3 T C 16: 30,351,387 K327R probably damaging Het
Cacna1s T C 1: 136,098,526 probably benign Het
Ccnk T C 12: 108,195,575 probably benign Het
Cep55 T C 19: 38,060,174 S93P possibly damaging Het
Cfh A G 1: 140,157,343 probably benign Het
Clptm1l A G 13: 73,606,343 T129A probably benign Het
Cntnap5a A G 1: 116,292,476 E672G probably benign Het
Cpped1 C A 16: 11,828,450 W170L probably damaging Het
Crygb T C 1: 65,081,941 I76V probably benign Het
Cyp3a25 A G 5: 145,994,936 S121P probably damaging Het
Cyp4b1 T C 4: 115,626,827 D395G probably damaging Het
Dll4 T C 2: 119,332,689 V597A probably damaging Het
Dsel T C 1: 111,859,952 D951G possibly damaging Het
Dync2h1 C A 9: 7,015,497 V3603F possibly damaging Het
Fam109a T A 5: 121,853,251 H225Q probably benign Het
Fam129a A G 1: 151,706,015 E454G probably benign Het
Fam167b C A 4: 129,578,285 A31S probably damaging Het
Fgfrl1 T A 5: 108,704,673 I25N probably damaging Het
Gzf1 C T 2: 148,684,649 R347* probably null Het
Heatr5b T A 17: 78,796,396 I1117F probably benign Het
Kntc1 T C 5: 123,769,704 V456A possibly damaging Het
Macc1 C A 12: 119,447,516 S673* probably null Het
Mpp4 T C 1: 59,121,422 E574G probably damaging Het
Muc20 C T 16: 32,793,488 M506I probably benign Het
Ncbp1 A G 4: 46,152,056 T218A probably benign Het
Nfxl1 A T 5: 72,559,130 V46E probably benign Het
Nfyc G T 4: 120,768,734 probably benign Het
Olfr561 T A 7: 102,774,532 S3T probably benign Het
Olfr972 A T 9: 39,873,347 Q24L probably damaging Het
Osbpl8 T C 10: 111,286,240 F681S possibly damaging Het
Pcm1 G C 8: 41,287,811 E1031D probably damaging Het
Pdcd11 A G 19: 47,127,291 E1486G probably benign Het
Pex12 G T 11: 83,298,034 A45E probably damaging Het
Pigm A G 1: 172,376,817 D40G probably damaging Het
Pkp1 G T 1: 135,880,740 N496K probably benign Het
Psmc4 T C 7: 28,048,862 I54V probably benign Het
Rbm33 T C 5: 28,394,483 V951A unknown Het
Selenbp2 G T 3: 94,697,502 probably benign Het
Slc3a1 G A 17: 85,060,835 W510* probably null Het
Stx12 A C 4: 132,857,390 probably benign Het
Tas2r125 G T 6: 132,910,122 D158Y probably benign Het
Tchp C A 5: 114,719,621 Q392K probably benign Het
Tmed11 T A 5: 108,778,989 D139V probably damaging Het
Ttn C T 2: 76,748,310 V24080M probably damaging Het
Ush2a G A 1: 188,951,525 G4967D probably damaging Het
Vezf1 T C 11: 88,073,330 S103P probably benign Het
Xpnpep3 T C 15: 81,430,842 S248P probably damaging Het
Yipf2 G C 9: 21,592,223 probably null Het
Zfp110 A T 7: 12,836,363 Q39L possibly damaging Het
Zfp287 A T 11: 62,714,213 C623S probably damaging Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
BB005:Dock7 UTSW 4 99001098 missense
BB015:Dock7 UTSW 4 99001098 missense
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
R7334:Dock7 UTSW 4 98975943 missense unknown
R7511:Dock7 UTSW 4 99061282 missense
R7511:Dock7 UTSW 4 99079755 nonsense probably null
R7729:Dock7 UTSW 4 99055446 missense
R7928:Dock7 UTSW 4 99001098 missense
R7984:Dock7 UTSW 4 98989066 missense unknown
R8287:Dock7 UTSW 4 98977920 missense unknown
R8439:Dock7 UTSW 4 99083029 missense
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98945225 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCACACGTAAGTTCACAGTGTGAC -3'
(R):5'- AGATAATTCCTGGCCGTCCTCCTG -3'

Sequencing Primer
(F):5'- TAAGTTCACAGTGTGACTAGGC -3'
(R):5'- GGACTCTAATCCTGTAGACAAGTGC -3'
Posted On2013-07-30