Incidental Mutation 'R8218:Dctn2'
ID636494
Institutional Source Beutler Lab
Gene Symbol Dctn2
Ensembl Gene ENSMUSG00000025410
Gene Namedynactin 2
SynonymsRBP50, p50, DCTN-50, C130077D06Rik, 2310042E05Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001190454.1, NM_001190453.1, NM_027151.2; MGI:107733

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8218 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127266368-127281950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127276529 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 170 (D170G)
Ref Sequence ENSEMBL: ENSMUSP00000026479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026479]
Predicted Effect probably damaging
Transcript: ENSMUST00000026479
AA Change: D170G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410
AA Change: D170G

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 50-kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 4-5 copies per dynactin molecule. It contains three short alpha-helical coiled-coil domains that may mediate association with self or other dynactin subunits. It may interact directly with the largest subunit (p150) of dynactin and may affix p150 in place. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI

All alleles(28) : Targeted(3) Gene trapped(25)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik G A 15: 84,955,467 H191Y probably damaging Het
5730480H06Rik T A 5: 48,379,427 L155* probably null Het
Ackr4 T C 9: 104,099,211 N179S probably benign Het
Acp5 T C 9: 22,129,606 Y107C probably damaging Het
Aff4 A T 11: 53,398,257 H411L probably damaging Het
Atp5f1 A G 3: 105,959,186 M1T probably null Het
Atp8b5 G A 4: 43,372,728 probably null Het
C1qtnf2 A G 11: 43,490,948 T166A possibly damaging Het
Dennd3 T A 15: 73,512,773 S10T probably benign Het
Ehbp1 T C 11: 22,096,096 Y551C possibly damaging Het
Eif4g2 A T 7: 111,074,432 D743E possibly damaging Het
Esr1 G A 10: 4,746,808 probably null Het
Exo1 A T 1: 175,900,914 I515L probably benign Het
Fam71f2 T C 6: 29,286,073 I177T probably damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Gcn1l1 G A 5: 115,581,529 S361N probably benign Het
Gm6337 C T 14: 6,050,613 probably null Het
Grk4 T A 5: 34,669,196 S47T probably benign Het
Gstp2 C A 19: 4,041,668 M20I probably benign Het
Harbi1 T C 2: 91,712,892 F233L probably benign Het
Iqch C T 9: 63,482,633 V755I possibly damaging Het
Iws1 T C 18: 32,093,635 F756L probably benign Het
Kcnh6 T G 11: 106,017,374 V272G possibly damaging Het
Kcnj10 C T 1: 172,368,972 R18C probably damaging Het
Kmt2c A C 5: 25,283,106 S4670A probably damaging Het
Krt80 T G 15: 101,370,003 M18L probably benign Het
Lbx1 A G 19: 45,234,920 V103A probably benign Het
March8 A T 6: 116,338,098 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Muc16 T A 9: 18,637,019 T5993S possibly damaging Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr1122 C T 2: 87,388,578 T291I probably damaging Het
Olfr346 A G 2: 36,688,673 T224A probably benign Het
Olfr99 A G 17: 37,279,820 V200A probably benign Het
Pbxip1 A G 3: 89,445,595 I183V probably benign Het
Pcdh20 T A 14: 88,468,611 I418F probably damaging Het
Pclo T C 5: 14,675,663 F1512L unknown Het
Phf2 G T 13: 48,804,628 T970K unknown Het
Pidd1 A G 7: 141,439,653 V698A probably damaging Het
Pik3ca T A 3: 32,437,847 V198D possibly damaging Het
Pip5k1c T A 10: 81,306,416 D153E probably damaging Het
Ppfia2 A G 10: 106,863,375 D795G probably benign Het
Pramef8 A T 4: 143,419,136 I392F probably benign Het
Prkar2a C A 9: 108,719,249 A131D possibly damaging Het
Pter A G 2: 12,980,555 D232G probably damaging Het
Qser1 C T 2: 104,762,923 R1583Q probably damaging Het
Rasal2 A C 1: 157,157,381 V932G probably damaging Het
Rasgrf2 G A 13: 91,982,677 A154V Het
Rbm4 A G 19: 4,787,416 Y347H probably damaging Het
Rfxank C A 8: 70,131,435 probably null Het
Robo1 C G 16: 72,989,790 R897G possibly damaging Het
Sash1 G A 10: 8,751,236 T364I probably damaging Het
Skint6 T A 4: 112,839,274 probably null Het
Slc22a4 T A 11: 53,986,581 M495L probably benign Het
Slc39a8 G A 3: 135,857,564 V212I probably benign Het
Slc40a1 A C 1: 45,910,969 V441G probably benign Het
Slc7a11 A T 3: 50,424,052 Y246N probably damaging Het
Spata9 T C 13: 75,977,773 V125A probably benign Het
Svopl T A 6: 38,014,806 M380L probably benign Het
Sycp2l T C 13: 41,118,068 Y23H probably damaging Het
Syt11 A T 3: 88,762,120 V155E probably benign Het
Syt5 T C 7: 4,542,823 Y147C probably damaging Het
Thg1l T C 11: 45,955,450 T6A probably benign Het
Tlr2 A G 3: 83,838,239 L179P probably damaging Het
Tsn A T 1: 118,305,254 Y107N probably damaging Het
Tspan32 A T 7: 143,011,095 Y114F probably benign Het
Tube1 A C 10: 39,147,379 S341R possibly damaging Het
Ubn2 T A 6: 38,489,279 V516D probably benign Het
Vmn1r21 G T 6: 57,843,925 T178K noncoding transcript Het
Vmn2r108 A G 17: 20,463,203 Y580H probably damaging Het
Wdr75 T A 1: 45,818,182 F546L probably damaging Het
Yy1 A G 12: 108,793,693 D94G probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfy2 T C Y: 2,133,421 T9A unknown Het
Other mutations in Dctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dctn2 APN 10 127277690 unclassified probably benign
IGL01749:Dctn2 APN 10 127281417 missense possibly damaging 0.47
IGL01797:Dctn2 APN 10 127277313 missense possibly damaging 0.94
IGL02021:Dctn2 APN 10 127275057 critical splice donor site probably null
IGL02335:Dctn2 APN 10 127275821 splice site probably benign
IGL02748:Dctn2 APN 10 127277273 missense probably damaging 1.00
IGL03382:Dctn2 APN 10 127278188 missense probably damaging 0.99
R0069:Dctn2 UTSW 10 127277485 splice site probably null
R0069:Dctn2 UTSW 10 127277485 splice site probably null
R0621:Dctn2 UTSW 10 127277940 critical splice donor site probably null
R1114:Dctn2 UTSW 10 127278142 splice site probably null
R1917:Dctn2 UTSW 10 127275049 nonsense probably null
R2238:Dctn2 UTSW 10 127276388 missense probably damaging 0.97
R4097:Dctn2 UTSW 10 127277493 missense probably damaging 1.00
R4418:Dctn2 UTSW 10 127278365 missense probably benign 0.24
R4972:Dctn2 UTSW 10 127276703 missense probably damaging 1.00
R6873:Dctn2 UTSW 10 127276236 splice site probably null
R7533:Dctn2 UTSW 10 127267478 missense possibly damaging 0.87
R7557:Dctn2 UTSW 10 127278404 missense probably benign 0.44
R7657:Dctn2 UTSW 10 127266514 missense probably damaging 1.00
R8557:Dctn2 UTSW 10 127278193 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTTTCTCCGAGGTTGC -3'
(R):5'- TAGTTGCTTCCAGCTGCAG -3'

Sequencing Primer
(F):5'- CTCACTTCCATCCTGTCTTACGGAC -3'
(R):5'- TTCCAGCTGCAGCAGTAAG -3'
Posted On2020-07-13