Incidental Mutation 'R8218:Aff4'
ID 636498
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8218 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53398257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 411 (H411L)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: H411L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: H411L

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
AA Change: H111L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470
AA Change: H111L

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik G A 15: 84,955,467 H191Y probably damaging Het
5730480H06Rik T A 5: 48,379,427 L155* probably null Het
Ackr4 T C 9: 104,099,211 N179S probably benign Het
Acp5 T C 9: 22,129,606 Y107C probably damaging Het
Atp5f1 A G 3: 105,959,186 M1T probably null Het
Atp8b5 G A 4: 43,372,728 probably null Het
C1qtnf2 A G 11: 43,490,948 T166A possibly damaging Het
Dctn2 A G 10: 127,276,529 D170G probably damaging Het
Dennd3 T A 15: 73,512,773 S10T probably benign Het
Ehbp1 T C 11: 22,096,096 Y551C possibly damaging Het
Eif4g2 A T 7: 111,074,432 D743E possibly damaging Het
Esr1 G A 10: 4,746,808 probably null Het
Exo1 A T 1: 175,900,914 I515L probably benign Het
Fam71f2 T C 6: 29,286,073 I177T probably damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Gcn1l1 G A 5: 115,581,529 S361N probably benign Het
Gm6337 C T 14: 6,050,613 probably null Het
Grk4 T A 5: 34,669,196 S47T probably benign Het
Gstp2 C A 19: 4,041,668 M20I probably benign Het
Harbi1 T C 2: 91,712,892 F233L probably benign Het
Iqch C T 9: 63,482,633 V755I possibly damaging Het
Iws1 T C 18: 32,093,635 F756L probably benign Het
Kcnh6 T G 11: 106,017,374 V272G possibly damaging Het
Kcnj10 C T 1: 172,368,972 R18C probably damaging Het
Kmt2c A C 5: 25,283,106 S4670A probably damaging Het
Krt80 T G 15: 101,370,003 M18L probably benign Het
Lbx1 A G 19: 45,234,920 V103A probably benign Het
March8 A T 6: 116,338,098 probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Muc16 T A 9: 18,637,019 T5993S possibly damaging Het
Olfr1048 C T 2: 86,236,518 V106M probably benign Het
Olfr1122 C T 2: 87,388,578 T291I probably damaging Het
Olfr346 A G 2: 36,688,673 T224A probably benign Het
Olfr99 A G 17: 37,279,820 V200A probably benign Het
Pbxip1 A G 3: 89,445,595 I183V probably benign Het
Pcdh20 T A 14: 88,468,611 I418F probably damaging Het
Pclo T C 5: 14,675,663 F1512L unknown Het
Phf2 G T 13: 48,804,628 T970K unknown Het
Pidd1 A G 7: 141,439,653 V698A probably damaging Het
Pik3ca T A 3: 32,437,847 V198D possibly damaging Het
Pip5k1c T A 10: 81,306,416 D153E probably damaging Het
Ppfia2 A G 10: 106,863,375 D795G probably benign Het
Pramef8 A T 4: 143,419,136 I392F probably benign Het
Prkar2a C A 9: 108,719,249 A131D possibly damaging Het
Pter A G 2: 12,980,555 D232G probably damaging Het
Qser1 C T 2: 104,762,923 R1583Q probably damaging Het
Rasal2 A C 1: 157,157,381 V932G probably damaging Het
Rasgrf2 G A 13: 91,982,677 A154V Het
Rbm4 A G 19: 4,787,416 Y347H probably damaging Het
Rfxank C A 8: 70,131,435 probably null Het
Robo1 C G 16: 72,989,790 R897G possibly damaging Het
Sash1 G A 10: 8,751,236 T364I probably damaging Het
Skint6 T A 4: 112,839,274 probably null Het
Slc22a4 T A 11: 53,986,581 M495L probably benign Het
Slc39a8 G A 3: 135,857,564 V212I probably benign Het
Slc40a1 A C 1: 45,910,969 V441G probably benign Het
Slc7a11 A T 3: 50,424,052 Y246N probably damaging Het
Spata9 T C 13: 75,977,773 V125A probably benign Het
Svopl T A 6: 38,014,806 M380L probably benign Het
Sycp2l T C 13: 41,118,068 Y23H probably damaging Het
Syt11 A T 3: 88,762,120 V155E probably benign Het
Syt5 T C 7: 4,542,823 Y147C probably damaging Het
Thg1l T C 11: 45,955,450 T6A probably benign Het
Tlr2 A G 3: 83,838,239 L179P probably damaging Het
Tsn A T 1: 118,305,254 Y107N probably damaging Het
Tspan32 A T 7: 143,011,095 Y114F probably benign Het
Tube1 A C 10: 39,147,379 S341R possibly damaging Het
Ubn2 T A 6: 38,489,279 V516D probably benign Het
Vmn1r21 G T 6: 57,843,925 T178K noncoding transcript Het
Vmn2r108 A G 17: 20,463,203 Y580H probably damaging Het
Wdr75 T A 1: 45,818,182 F546L probably damaging Het
Yy1 A G 12: 108,793,693 D94G probably benign Het
Zfhx3 A G 8: 108,950,717 T2800A probably benign Het
Zfy2 T C Y: 2,133,421 T9A unknown Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACATTGTGGTGGTATCATTAGCAG -3'
(R):5'- GATGACATCCACGGCTGAAG -3'

Sequencing Primer
(F):5'- AGCAGCCTTATAAATAATGTCAGTTG -3'
(R):5'- CGGCTGTCAGGAGAGCTTGAG -3'
Posted On 2020-07-13