Incidental Mutation 'R8219:Slc24a5'
ID636526
Institutional Source Beutler Lab
Gene Symbol Slc24a5
Ensembl Gene ENSMUSG00000035183
Gene Namesolute carrier family 24, member 5
SynonymsOca6, NCX5, F630045L20Rik, NCKX5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location125068124-125088677 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 125085655 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067780] [ENSMUST00000070353] [ENSMUST00000110501] [ENSMUST00000142718] [ENSMUST00000147105] [ENSMUST00000152367]
Predicted Effect probably benign
Transcript: ENSMUST00000067780
SMART Domains Protein: ENSMUSP00000066312
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000070353
SMART Domains Protein: ENSMUSP00000063887
Gene: ENSMUSG00000035183

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Na_Ca_ex 72 216 1.1e-24 PFAM
low complexity region 274 290 N/A INTRINSIC
low complexity region 311 324 N/A INTRINSIC
Pfam:Na_Ca_ex 334 485 7.6e-31 PFAM
low complexity region 488 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089825
SMART Domains Protein: ENSMUSP00000087258
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 48 121 1.84e-22 SMART
low complexity region 154 167 N/A INTRINSIC
RRM 181 253 5.12e-21 SMART
low complexity region 274 291 N/A INTRINSIC
low complexity region 386 406 N/A INTRINSIC
RRM 454 525 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110501
SMART Domains Protein: ENSMUSP00000106127
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142718
SMART Domains Protein: ENSMUSP00000115519
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
RRM 491 562 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147105
SMART Domains Protein: ENSMUSP00000114817
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
RRM 474 545 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152367
SMART Domains Protein: ENSMUSP00000123088
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
RRM 515 586 6.15e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the potassium-dependent sodium/calcium exchanger family and encodes an intracellular membrane protein with 2 large hydrophilic loops and 2 sets of multiple transmembrane-spanning segments. Sequence variation in this gene has been associated with differences in skin pigmentation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypopigmentation and ocular albinism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Slc24a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Slc24a5 APN 2 125080889 missense probably damaging 1.00
IGL01307:Slc24a5 APN 2 125080880 missense probably damaging 1.00
IGL01926:Slc24a5 APN 2 125068903 missense probably benign 0.01
IGL02090:Slc24a5 APN 2 125068298 missense probably benign 0.25
IGL02313:Slc24a5 APN 2 125085647 unclassified probably benign
IGL02328:Slc24a5 APN 2 125080639 missense probably damaging 1.00
IGL02743:Slc24a5 APN 2 125088234 missense probably damaging 1.00
IGL02969:Slc24a5 APN 2 125083227 missense probably damaging 1.00
IGL03212:Slc24a5 APN 2 125080830 missense probably damaging 1.00
IGL03258:Slc24a5 APN 2 125080705 critical splice donor site probably null
R0344:Slc24a5 UTSW 2 125085701 missense probably benign 0.03
R0811:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R0812:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R1018:Slc24a5 UTSW 2 125068907 missense probably damaging 1.00
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1753:Slc24a5 UTSW 2 125083195 missense possibly damaging 0.53
R2147:Slc24a5 UTSW 2 125087441 missense probably damaging 1.00
R4934:Slc24a5 UTSW 2 125088020 missense probably damaging 1.00
R4964:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R4966:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R5225:Slc24a5 UTSW 2 125085819 missense probably damaging 0.99
R5275:Slc24a5 UTSW 2 125085861 missense probably benign 0.09
R5438:Slc24a5 UTSW 2 125068865 missense probably damaging 1.00
R5866:Slc24a5 UTSW 2 125085671 missense probably damaging 1.00
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6114:Slc24a5 UTSW 2 125083092 missense probably benign 0.01
R6211:Slc24a5 UTSW 2 125088251 missense probably benign 0.23
R6516:Slc24a5 UTSW 2 125088107 missense probably benign 0.01
R6675:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6677:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6826:Slc24a5 UTSW 2 125068858 missense probably benign 0.00
R7100:Slc24a5 UTSW 2 125080671 missense probably damaging 1.00
R7122:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
R7381:Slc24a5 UTSW 2 125068949 missense probably benign 0.29
R7398:Slc24a5 UTSW 2 125085774 nonsense probably null
R7401:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
X0067:Slc24a5 UTSW 2 125087503 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTTACATTTCTTCTGACCAGCAG -3'
(R):5'- GAATGCAGATATCCATAGTGCAGAC -3'

Sequencing Primer
(F):5'- ATGCTGAGACCGTTTGACAC -3'
(R):5'- TGCAGACATGAAAAAGGTTATCAC -3'
Posted On2020-07-13