Incidental Mutation 'R8219:Tgm6'
ID636527
Institutional Source Beutler Lab
Gene Symbol Tgm6
Ensembl Gene ENSMUSG00000027403
Gene Nametransglutaminase 6
SynonymsTGM3L
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location130112416-130154232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130151280 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 562 (K562R)
Ref Sequence ENSEMBL: ENSMUSP00000028888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028888]
Predicted Effect probably benign
Transcript: ENSMUST00000028888
AA Change: K562R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028888
Gene: ENSMUSG00000027403
AA Change: K562R

DomainStartEndE-ValueType
Pfam:Transglut_N 5 119 3e-31 PFAM
TGc 266 359 3.48e-40 SMART
low complexity region 466 483 N/A INTRINSIC
Pfam:Transglut_C 495 600 2.4e-23 PFAM
Pfam:Transglut_C 607 704 4.7e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the transglutaminase superfamily. It catalyzes the cross-linking of proteins and the conjugation of polyamines to proteins. Mutations in this gene are associated with spinocerebellar ataxia type 35 (SCA35). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Tgm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Tgm6 APN 2 130136495 missense probably benign 0.00
IGL01331:Tgm6 APN 2 130143618 splice site probably null
IGL01348:Tgm6 APN 2 130137379 missense probably damaging 1.00
IGL01787:Tgm6 APN 2 130151434 splice site probably benign
IGL02208:Tgm6 APN 2 130135870 missense probably benign 0.11
IGL02656:Tgm6 APN 2 130145103 missense probably damaging 1.00
IGL03280:Tgm6 APN 2 130138931 missense probably damaging 1.00
R0200:Tgm6 UTSW 2 130152945 splice site probably null
R0507:Tgm6 UTSW 2 130138831 missense possibly damaging 0.56
R0744:Tgm6 UTSW 2 130151761 missense probably benign 0.00
R0800:Tgm6 UTSW 2 130143422 missense possibly damaging 0.94
R1530:Tgm6 UTSW 2 130151282 missense possibly damaging 0.71
R1573:Tgm6 UTSW 2 130151740 missense probably benign 0.00
R1706:Tgm6 UTSW 2 130145159 missense possibly damaging 0.53
R2330:Tgm6 UTSW 2 130143242 missense probably damaging 1.00
R2881:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R2882:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R3622:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R3624:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R4370:Tgm6 UTSW 2 130143605 missense probably benign 0.12
R4664:Tgm6 UTSW 2 130137394 missense probably benign 0.05
R4664:Tgm6 UTSW 2 130141208 missense probably benign 0.34
R4983:Tgm6 UTSW 2 130141193 missense probably damaging 0.99
R5182:Tgm6 UTSW 2 130141302 missense probably damaging 0.98
R5397:Tgm6 UTSW 2 130141908 missense possibly damaging 0.90
R5411:Tgm6 UTSW 2 130145196 missense probably benign 0.01
R5683:Tgm6 UTSW 2 130138955 missense probably damaging 1.00
R5933:Tgm6 UTSW 2 130141256 missense probably damaging 1.00
R6016:Tgm6 UTSW 2 130141228 missense probably damaging 0.99
R7252:Tgm6 UTSW 2 130144964 missense probably damaging 1.00
R7290:Tgm6 UTSW 2 130141190 missense probably damaging 1.00
R7581:Tgm6 UTSW 2 130141285 missense probably damaging 1.00
R8143:Tgm6 UTSW 2 130141843 missense probably damaging 0.98
R8153:Tgm6 UTSW 2 130145055 missense probably benign 0.00
R8297:Tgm6 UTSW 2 130137438 missense probably benign
R8743:Tgm6 UTSW 2 130143498 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTGTATCAAGCATTTCCATCTTG -3'
(R):5'- AGATGAAGCTGGTGCCCAAG -3'

Sequencing Primer
(F):5'- CTTGGATAAATATGAAGTTTGTGCAG -3'
(R):5'- AAGGCTCAGACCCCAGGTTTG -3'
Posted On2020-07-13