Incidental Mutation 'R8219:Ttf2'
ID636529
Institutional Source Beutler Lab
Gene Symbol Ttf2
Ensembl Gene ENSMUSG00000033222
Gene Nametranscription termination factor, RNA polymerase II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location100938860-100969663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100962563 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 398 (K398T)
Ref Sequence ENSEMBL: ENSMUSP00000076208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076941
AA Change: K398T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076208
Gene: ENSMUSG00000033222
AA Change: K398T

DomainStartEndE-ValueType
Pfam:zf-GRF 4 44 2.3e-10 PFAM
low complexity region 328 340 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 458 479 N/A INTRINSIC
DEXDc 542 774 8.6e-35 SMART
Blast:DEXDc 839 892 8e-7 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 917 932 N/A INTRINSIC
HELICc 999 1082 5.61e-16 SMART
low complexity region 1099 1110 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI2/SNF2 family of proteins, which play a critical role in altering protein-DNA interactions. The encoded protein has been shown to have dsDNA-dependent ATPase activity and RNA polymerase II termination activity. This protein interacts with cell division cycle 5-like, associates with human splicing complexes, and plays a role in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Ttf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Ttf2 APN 3 100967097 splice site probably benign
IGL01578:Ttf2 APN 3 100956195 missense possibly damaging 0.59
IGL02218:Ttf2 APN 3 100964093 missense possibly damaging 0.61
IGL03267:Ttf2 APN 3 100944804 nonsense probably null
FR4548:Ttf2 UTSW 3 100963160 small insertion probably benign
FR4737:Ttf2 UTSW 3 100963160 small insertion probably benign
R0784:Ttf2 UTSW 3 100962710 missense probably benign 0.01
R0894:Ttf2 UTSW 3 100969549 splice site probably benign
R2083:Ttf2 UTSW 3 100969501 missense probably benign 0.18
R2125:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2126:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2230:Ttf2 UTSW 3 100957944 missense probably damaging 0.99
R3084:Ttf2 UTSW 3 100948264 missense possibly damaging 0.56
R3700:Ttf2 UTSW 3 100951008 missense probably damaging 1.00
R3963:Ttf2 UTSW 3 100941820 unclassified probably benign
R4002:Ttf2 UTSW 3 100948225 nonsense probably null
R4290:Ttf2 UTSW 3 100962761 missense probably benign 0.01
R4833:Ttf2 UTSW 3 100961406 missense probably benign 0.00
R4909:Ttf2 UTSW 3 100954315 missense probably damaging 1.00
R5011:Ttf2 UTSW 3 100963169 missense probably benign 0.14
R5523:Ttf2 UTSW 3 100959242 missense probably damaging 1.00
R5669:Ttf2 UTSW 3 100951117 nonsense probably null
R6531:Ttf2 UTSW 3 100956260 missense probably damaging 0.99
R6776:Ttf2 UTSW 3 100952553 missense probably benign 0.01
R6795:Ttf2 UTSW 3 100959262 missense probably damaging 1.00
R6861:Ttf2 UTSW 3 100969625 missense possibly damaging 0.89
R6940:Ttf2 UTSW 3 100969515 missense probably damaging 1.00
R6958:Ttf2 UTSW 3 100945932 missense probably benign 0.30
R6962:Ttf2 UTSW 3 100951137 missense probably damaging 1.00
R7211:Ttf2 UTSW 3 100959307 missense probably benign 0.00
R7365:Ttf2 UTSW 3 100963302 missense possibly damaging 0.92
R7470:Ttf2 UTSW 3 100963162 missense possibly damaging 0.85
R7534:Ttf2 UTSW 3 100950412 splice site probably null
R8023:Ttf2 UTSW 3 100956255 missense probably benign 0.01
R8087:Ttf2 UTSW 3 100964096 missense probably damaging 0.96
R8757:Ttf2 UTSW 3 100950332 missense probably damaging 1.00
R8872:Ttf2 UTSW 3 100963328 missense probably benign 0.04
R8888:Ttf2 UTSW 3 100962712 missense probably benign 0.00
R8895:Ttf2 UTSW 3 100962712 missense probably benign 0.00
R8900:Ttf2 UTSW 3 100952640 missense probably damaging 1.00
R8942:Ttf2 UTSW 3 100961726 missense probably benign 0.00
RF027:Ttf2 UTSW 3 100963157 small insertion probably benign
RF035:Ttf2 UTSW 3 100963157 small insertion probably benign
Z1177:Ttf2 UTSW 3 100959266 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAGTCAAGACTGGCCTG -3'
(R):5'- GCGAAGATGATGGTGTTTCC -3'

Sequencing Primer
(F):5'- CAAGACTGGCCTGCTGTTTTG -3'
(R):5'- TTTCCAGTAGGCCGGGGTC -3'
Posted On2020-07-13