Incidental Mutation 'R8219:Xpa'
ID636532
Institutional Source Beutler Lab
Gene Symbol Xpa
Ensembl Gene ENSMUSG00000028329
Gene Namexeroderma pigmentosum, complementation group A
SynonymsXpac
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8219 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46155347-46196311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46183150 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 213 (M213K)
Ref Sequence ENSEMBL: ENSMUSP00000050453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030013] [ENSMUST00000058232] [ENSMUST00000132358] [ENSMUST00000142380]
Predicted Effect probably benign
Transcript: ENSMUST00000030013
AA Change: M213K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030013
Gene: ENSMUSG00000028329
AA Change: M213K

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058232
AA Change: M213K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329
AA Change: M213K

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132358
AA Change: M104K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138512
Gene: ENSMUSG00000028329
AA Change: M104K

DomainStartEndE-ValueType
Pfam:XPA_N 1 23 1.1e-13 PFAM
Pfam:XPA_C 24 76 7.9e-29 PFAM
low complexity region 103 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142380
AA Change: M213K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121850
Gene: ENSMUSG00000028329
AA Change: M213K

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in DNA excision repair. The encoded protein is part of the NER (nucleotide excision repair) complext which is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens. Mutations in this gene are associated with xeroderma pigmentosum complementation group A. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mutants are highly susceptible to tumors induced by UV (skin and ocular tumors), 7,12-dimethylbenz[a]anthracene (skin tumors), benzo[a]pyrene (pulmonary tumors), 4-nitroquinoline-1-oxide (tongue tumors) and aflatoxin B(1) (liver tumors). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Xpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Xpa APN 4 46185606 missense probably damaging 1.00
IGL02670:Xpa APN 4 46185682 missense probably benign 0.03
R1863:Xpa UTSW 4 46155730 intron probably benign
R2149:Xpa UTSW 4 46183189 missense probably damaging 0.99
R4534:Xpa UTSW 4 46185624 missense probably benign 0.00
R5308:Xpa UTSW 4 46185659 missense probably benign 0.00
R6647:Xpa UTSW 4 46183089 missense probably benign 0.00
R7157:Xpa UTSW 4 46185612 missense probably damaging 1.00
R7185:Xpa UTSW 4 46183078 missense probably benign
R8191:Xpa UTSW 4 46183225 missense possibly damaging 0.56
Z1177:Xpa UTSW 4 46183036 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GATGCCTAATCCCACTGTCC -3'
(R):5'- ATGACATCTGTGAGCTCGAC -3'

Sequencing Primer
(F):5'- TGACTTACATGAAAACGATGGCC -3'
(R):5'- CATCTGTGAGCTCGACAGTTAGGAC -3'
Posted On2020-07-13