Incidental Mutation 'R8219:Atg9b'
ID636540
Institutional Source Beutler Lab
Gene Symbol Atg9b
Ensembl Gene ENSMUSG00000038295
Gene Nameautophagy related 9B
SynonymsLOC213948, Apg9l2, Nos3as, eONE
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24384181-24392143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24386332 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 756 (L756P)
Ref Sequence ENSEMBL: ENSMUSP00000051864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000059401] [ENSMUST00000115090]
Predicted Effect probably benign
Transcript: ENSMUST00000030834
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059401
AA Change: L756P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051864
Gene: ENSMUSG00000038295
AA Change: L756P

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
transmembrane domain 279 296 N/A INTRINSIC
Pfam:APG9 321 681 1.2e-100 PFAM
low complexity region 782 799 N/A INTRINSIC
low complexity region 838 847 N/A INTRINSIC
low complexity region 854 871 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115090
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Atg9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Atg9b APN 5 24386515 splice site probably null
IGL02020:Atg9b APN 5 24391058 missense possibly damaging 0.89
PIT4418001:Atg9b UTSW 5 24385515 missense possibly damaging 0.93
R0045:Atg9b UTSW 5 24387398 missense probably damaging 0.99
R1698:Atg9b UTSW 5 24388188 missense probably damaging 1.00
R1807:Atg9b UTSW 5 24387057 missense probably damaging 1.00
R1885:Atg9b UTSW 5 24388254 missense probably damaging 1.00
R2183:Atg9b UTSW 5 24390493 missense probably benign 0.01
R2224:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2226:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2227:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2426:Atg9b UTSW 5 24386994 missense probably damaging 1.00
R2919:Atg9b UTSW 5 24391544 missense possibly damaging 0.66
R3003:Atg9b UTSW 5 24391219 missense probably damaging 1.00
R4772:Atg9b UTSW 5 24385239 makesense probably null
R4786:Atg9b UTSW 5 24386089 missense possibly damaging 0.92
R5901:Atg9b UTSW 5 24392019 unclassified probably benign
R6410:Atg9b UTSW 5 24386110 missense possibly damaging 0.46
R6505:Atg9b UTSW 5 24390577 missense probably damaging 1.00
R7215:Atg9b UTSW 5 24388041 missense probably damaging 1.00
R8134:Atg9b UTSW 5 24385222 critical splice donor site probably null
R8257:Atg9b UTSW 5 24386305 unclassified probably benign
R8460:Atg9b UTSW 5 24386968 missense probably damaging 0.97
R8671:Atg9b UTSW 5 24386109 missense probably benign 0.08
R8774:Atg9b UTSW 5 24390573 missense probably damaging 1.00
R8774-TAIL:Atg9b UTSW 5 24390573 missense probably damaging 1.00
R8870:Atg9b UTSW 5 24387034 missense probably damaging 1.00
R8966:Atg9b UTSW 5 24391202 critical splice donor site probably null
R8969:Atg9b UTSW 5 24387834 missense probably benign 0.00
Z1177:Atg9b UTSW 5 24391787 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTCTGGCTAAACAAAAGAGAGC -3'
(R):5'- TGGCTTTCAGAGGGACAGAC -3'

Sequencing Primer
(F):5'- CTAAACAAAAGAGAGCCAAAGGGTG -3'
(R):5'- TCACTCTCTCAGCGTGCAGAG -3'
Posted On2020-07-13