Incidental Mutation 'R8219:Borcs5'
ID636546
Institutional Source Beutler Lab
Gene Symbol Borcs5
Ensembl Gene ENSMUSG00000042992
Gene NameBLOC-1 related complex subunit 5
Synonyms5830457J20Rik, Loh12cr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location134639510-134711187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134644350 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 27 (H27R)
Ref Sequence ENSEMBL: ENSMUSP00000054913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062755] [ENSMUST00000166591]
Predicted Effect probably benign
Transcript: ENSMUST00000062755
AA Change: H27R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000054913
Gene: ENSMUSG00000042992
AA Change: H27R

DomainStartEndE-ValueType
Pfam:LOH1CR12 61 191 7.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166591
AA Change: H28R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127413
Gene: ENSMUSG00000042992
AA Change: H28R

DomainStartEndE-ValueType
Pfam:LOH1CR12 62 192 5.7e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Borcs5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1174:Borcs5 UTSW 6 134710133 missense probably damaging 1.00
R1175:Borcs5 UTSW 6 134710133 missense probably damaging 1.00
R1290:Borcs5 UTSW 6 134644368 missense possibly damaging 0.63
R1951:Borcs5 UTSW 6 134710267 missense unknown
R1953:Borcs5 UTSW 6 134710267 missense unknown
R1972:Borcs5 UTSW 6 134710174 missense probably damaging 0.99
R4378:Borcs5 UTSW 6 134644329 missense probably benign
R5622:Borcs5 UTSW 6 134686123 critical splice donor site probably null
R6543:Borcs5 UTSW 6 134710180 missense probably damaging 1.00
R6899:Borcs5 UTSW 6 134710210 missense probably benign 0.00
R7313:Borcs5 UTSW 6 134710180 missense probably damaging 1.00
R7405:Borcs5 UTSW 6 134685982 missense probably benign 0.09
R7555:Borcs5 UTSW 6 134685979 missense probably benign 0.01
R8944:Borcs5 UTSW 6 134644474 critical splice donor site probably null
Z1176:Borcs5 UTSW 6 134710123 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AAGGAGACAGCACCACTCTTG -3'
(R):5'- GTTTGTACATAAGCTTCCCCAG -3'

Sequencing Primer
(F):5'- CAGAAAATCTTTCACTGGGCCTGG -3'
(R):5'- GCAAGTCCAGATATCACAGAAGTCTC -3'
Posted On2020-07-13