Mutagenetix > Incidental Mutation

Incidental Mutation 'R8219:Trpm1'

636551

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8219 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64201951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 139 (Q139L)

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206107] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: Q139L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: Q139L

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177102
AA Change: Q23L

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: Q23L

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348
AA Change: Q139L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

probably benign
Transcript: ENSMUST00000205690

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205731
AA Change: Q23L

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000206049

Predicted Effect

probably benign
Transcript: ENSMUST00000206107
AA Change: Q23L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: Q23L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: Q139L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206314
AA Change: Q139L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206706
AA Change: Q6L

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933414I15Rik	A	T	11: 50,942,536	S80T	unknown	Het
Acnat1	T	A	4: 49,447,748	I278F	probably benign	Het
Adgrf5	A	T	17: 43,449,859	Q815L	probably benign	Het
Aff1	T	A	5: 103,846,333	Y1022N	probably damaging	Het
Ahi1	A	G	10: 21,074,436	K1034E	probably benign	Het
Ano8	A	T	8: 71,480,713	L645Q	unknown	Het
Atg9b	A	G	5: 24,386,332	L756P	probably damaging	Het
Atp2b2	A	T	6: 113,793,850	I411N	probably damaging	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Bmp6	T	A	13: 38,345,987	C19S	unknown	Het
Borcs5	A	G	6: 134,644,350	H27R	probably benign	Het
C77080	T	A	4: 129,248,153	D65V	possibly damaging	Het
Cachd1	C	A	4: 100,990,962	D1091E	probably benign	Het
Ccdc186	T	A	19: 56,793,345	M801L	probably benign	Het
Clcn3	A	T	8: 60,922,966	M658K	probably damaging	Het
Col1a1	C	T	11: 94,943,358	R500C	probably damaging	Het
Cul4a	T	A	8: 13,146,540	D731E	possibly damaging	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
E2f7	T	A	10: 110,759,843	V133E	probably damaging	Het
Fam161b	T	C	12: 84,346,874	E575G	probably benign	Het
Fubp1	T	A	3: 152,220,466	V275D	probably damaging	Het
Gabrg1	T	A	5: 70,774,300	R367*	probably null	Het
Gm6902	G	A	7: 23,273,718	A128V	probably benign	Het
Gnptab	A	G	10: 88,433,792	T786A	probably benign	Het
Golga2	A	G	2: 32,306,480	N981D	probably damaging	Het
Gsap	A	T	5: 21,251,115	I437L	probably benign	Het
Gulp1	A	G	1: 44,754,341		probably null	Het
Kcnn1	T	C	8: 70,852,855	Y237C	probably damaging	Het
Klhl28	A	T	12: 64,951,657	N354K	probably benign	Het
Lama3	T	C	18: 12,439,360	Y541H	probably benign	Het
Lamc1	A	G	1: 153,247,327	Y706H	probably damaging	Het
Lima1	G	T	15: 99,780,790	T590K	probably damaging	Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Mrgprb8	G	A	7: 48,388,901	V107M	possibly damaging	Het
Mrpl3	T	A	9: 105,057,072	N139K	possibly damaging	Het
Nudt16	T	A	9: 105,130,437	N161I	probably damaging	Het
Obscn	G	A	11: 59,122,748	S1091L	probably benign	Het
Olfr1458	A	C	19: 13,102,920	L122R	probably damaging	Het
Olfr894	A	C	9: 38,219,372	D183A	probably damaging	Het
Oog4	T	C	4: 143,439,938	M99V	probably benign	Het
Osbpl6	A	T	2: 76,555,903	D303V	probably damaging	Het
Pcdhb21	T	C	18: 37,514,655	F279S	probably damaging	Het
Peg3	G	A	7: 6,708,365	T1286I	probably benign	Het
Phax	A	G	18: 56,575,682	N106S	probably damaging	Het
Pkdrej	A	G	15: 85,821,292	Y148H	probably damaging	Het
Ptprn2	C	A	12: 117,184,737	Q706K	probably benign	Het
Rdh11	T	G	12: 79,189,106	K23Q	probably benign	Het
Rit2	T	A	18: 30,975,494	E146V	probably damaging	Het
Rnf141	T	C	7: 110,837,265		probably benign	Het
Sars	T	A	3: 108,445,062	E24V	probably benign	Het
Sh3tc2	A	G	18: 62,011,861	I1129V	probably benign	Het
Slc10a5	G	T	3: 10,335,324	P92Q	probably benign	Het
Slc24a5	A	T	2: 125,085,655		probably null	Het
Slc5a8	A	G	10: 88,921,699	Y517C	probably damaging	Het
Slc6a5	A	G	7: 49,912,163	M148V	probably benign	Het
Sorl1	T	C	9: 42,041,561		probably null	Het
Tgm4	A	T	9: 123,045,052	Y119F	probably benign	Het
Tgm6	A	G	2: 130,151,280	K562R	probably benign	Het
Tlr3	T	C	8: 45,397,979	E627G	possibly damaging	Het
Tmprss11f	A	G	5: 86,530,019	L297P	probably damaging	Het
Tpbgl	T	C	7: 99,625,771	H293R	probably benign	Het
Trank1	A	C	9: 111,364,909	K667T	probably damaging	Het
Ttf2	T	G	3: 100,962,563	K398T	possibly damaging	Het
Xpa	A	T	4: 46,183,150	M213K	probably benign	Het
Zmym2	T	A	14: 56,925,859	S623T	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCCCCAAGATATAGAGAGCCTC -3'
(R):5'- GCAGCTTCAGTGAGTCCATC -3'

Sequencing Primer
(F):5'- GATATAGAGAGCCTCCAGACACTG -3'
(R):5'- TTCAGTGAGTCCATCAGCGCAG -3'

Posted On

2020-07-13