Incidental Mutation 'R8219:Trpm1'
ID 636551
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 067659-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8219 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63851699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 139 (Q139L)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206107] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]
AlphaFold Q2TV84
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: Q139L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: Q139L

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000177102
AA Change: Q23L

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: Q23L

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000205348
AA Change: Q139L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000205684
Predicted Effect probably benign
Transcript: ENSMUST00000205690
Predicted Effect possibly damaging
Transcript: ENSMUST00000205731
AA Change: Q23L

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000206049
Predicted Effect probably benign
Transcript: ENSMUST00000206107
AA Change: Q23L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000206263
AA Change: Q23L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: Q139L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206314
AA Change: Q139L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206706
AA Change: Q6L

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,833,363 (GRCm39) S80T unknown Het
Acnat1 T A 4: 49,447,748 (GRCm39) I278F probably benign Het
Adgrf5 A T 17: 43,760,750 (GRCm39) Q815L probably benign Het
Aff1 T A 5: 103,994,199 (GRCm39) Y1022N probably damaging Het
Ahi1 A G 10: 20,950,335 (GRCm39) K1034E probably benign Het
Ano8 A T 8: 71,933,357 (GRCm39) L645Q unknown Het
Atg9b A G 5: 24,591,330 (GRCm39) L756P probably damaging Het
Atp2b2 A T 6: 113,770,811 (GRCm39) I411N probably damaging Het
Bmp6 T A 13: 38,529,963 (GRCm39) C19S unknown Het
Borcs5 A G 6: 134,621,313 (GRCm39) H27R probably benign Het
Cachd1 C A 4: 100,848,159 (GRCm39) D1091E probably benign Het
Ccdc186 T A 19: 56,781,777 (GRCm39) M801L probably benign Het
Clcn3 A T 8: 61,376,000 (GRCm39) M658K probably damaging Het
Col1a1 C T 11: 94,834,184 (GRCm39) R500C probably damaging Het
Cul4a T A 8: 13,196,540 (GRCm39) D731E possibly damaging Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
E2f7 T A 10: 110,595,704 (GRCm39) V133E probably damaging Het
Fam161b T C 12: 84,393,648 (GRCm39) E575G probably benign Het
Fubp1 T A 3: 151,926,103 (GRCm39) V275D probably damaging Het
Gabrg1 T A 5: 70,931,643 (GRCm39) R367* probably null Het
Gm6902 G A 7: 22,973,143 (GRCm39) A128V probably benign Het
Gnptab A G 10: 88,269,654 (GRCm39) T786A probably benign Het
Golga2 A G 2: 32,196,492 (GRCm39) N981D probably damaging Het
Gsap A T 5: 21,456,113 (GRCm39) I437L probably benign Het
Gulp1 A G 1: 44,793,501 (GRCm39) probably null Het
Kcnn1 T C 8: 71,305,499 (GRCm39) Y237C probably damaging Het
Klhl28 A T 12: 64,998,431 (GRCm39) N354K probably benign Het
Lama3 T C 18: 12,572,417 (GRCm39) Y541H probably benign Het
Lamc1 A G 1: 153,123,073 (GRCm39) Y706H probably damaging Het
Lima1 G T 15: 99,678,671 (GRCm39) T590K probably damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Mrgprb8 G A 7: 48,038,649 (GRCm39) V107M possibly damaging Het
Mrpl3 T A 9: 104,934,271 (GRCm39) N139K possibly damaging Het
Nhsl3 T A 4: 129,141,946 (GRCm39) D65V possibly damaging Het
Nudt16 T A 9: 105,007,636 (GRCm39) N161I probably damaging Het
Obscn G A 11: 59,013,574 (GRCm39) S1091L probably benign Het
Oog4 T C 4: 143,166,508 (GRCm39) M99V probably benign Het
Or5b105 A C 19: 13,080,284 (GRCm39) L122R probably damaging Het
Or8c16 A C 9: 38,130,668 (GRCm39) D183A probably damaging Het
Osbpl6 A T 2: 76,386,247 (GRCm39) D303V probably damaging Het
Pcdhb21 T C 18: 37,647,708 (GRCm39) F279S probably damaging Het
Peg3 G A 7: 6,711,364 (GRCm39) T1286I probably benign Het
Phax A G 18: 56,708,754 (GRCm39) N106S probably damaging Het
Pkdrej A G 15: 85,705,493 (GRCm39) Y148H probably damaging Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Ptprn2 C A 12: 117,148,357 (GRCm39) Q706K probably benign Het
Rdh11 T G 12: 79,235,880 (GRCm39) K23Q probably benign Het
Rit2 T A 18: 31,108,547 (GRCm39) E146V probably damaging Het
Rnf141 T C 7: 110,436,472 (GRCm39) probably benign Het
Sars1 T A 3: 108,352,378 (GRCm39) E24V probably benign Het
Sh3tc2 A G 18: 62,144,932 (GRCm39) I1129V probably benign Het
Slc10a5 G T 3: 10,400,384 (GRCm39) P92Q probably benign Het
Slc24a5 A T 2: 124,927,575 (GRCm39) probably null Het
Slc5a8 A G 10: 88,757,561 (GRCm39) Y517C probably damaging Het
Slc6a5 A G 7: 49,561,911 (GRCm39) M148V probably benign Het
Sorl1 T C 9: 41,952,857 (GRCm39) probably null Het
Tgm4 A T 9: 122,874,117 (GRCm39) Y119F probably benign Het
Tgm6 A G 2: 129,993,200 (GRCm39) K562R probably benign Het
Tlr3 T C 8: 45,851,016 (GRCm39) E627G possibly damaging Het
Tmprss11f A G 5: 86,677,878 (GRCm39) L297P probably damaging Het
Tpbgl T C 7: 99,274,978 (GRCm39) H293R probably benign Het
Trank1 A C 9: 111,193,977 (GRCm39) K667T probably damaging Het
Ttf2 T G 3: 100,869,879 (GRCm39) K398T possibly damaging Het
Xpa A T 4: 46,183,150 (GRCm39) M213K probably benign Het
Zmym2 T A 14: 57,163,316 (GRCm39) S623T probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R0510:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCCCCAAGATATAGAGAGCCTC -3'
(R):5'- GCAGCTTCAGTGAGTCCATC -3'

Sequencing Primer
(F):5'- GATATAGAGAGCCTCCAGACACTG -3'
(R):5'- TTCAGTGAGTCCATCAGCGCAG -3'
Posted On 2020-07-13