Incidental Mutation 'R8219:Rnf141'
ID636553
Institutional Source Beutler Lab
Gene Symbol Rnf141
Ensembl Gene ENSMUSG00000030788
Gene Namering finger protein 141
Synonyms2610110L04Rik, ZFP36, ZNF230
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location110800432-110844457 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 110837265 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106682] [ENSMUST00000175981] [ENSMUST00000176716] [ENSMUST00000176746] [ENSMUST00000177236] [ENSMUST00000177462] [ENSMUST00000177520]
Predicted Effect probably benign
Transcript: ENSMUST00000106682
SMART Domains Protein: ENSMUSP00000102293
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175981
SMART Domains Protein: ENSMUSP00000135123
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
RING 58 94 3.39e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176716
Predicted Effect probably benign
Transcript: ENSMUST00000176746
Predicted Effect probably benign
Transcript: ENSMUST00000177236
SMART Domains Protein: ENSMUSP00000134781
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177462
SMART Domains Protein: ENSMUSP00000134917
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
PDB:2ECN|A 144 180 3e-21 PDB
SCOP:d1fbva4 146 180 3e-7 SMART
Blast:RING 155 180 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177520
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. Abundant expression of this gene was found in the testicular tissue of fertile men, but was not detected in azoospermic patients. Studies of the mouse counterpart suggest that this gene may function as a testis specific transcription factor during spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit decreased litter size but normal spermatogeness and testes weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Rnf141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rnf141 APN 7 110833734 unclassified probably benign
IGL02246:Rnf141 APN 7 110825287 missense probably benign
IGL02336:Rnf141 APN 7 110837198 nonsense probably null
R0482:Rnf141 UTSW 7 110837138 nonsense probably null
R1324:Rnf141 UTSW 7 110816843 nonsense probably null
R1718:Rnf141 UTSW 7 110821273 missense probably damaging 1.00
R2067:Rnf141 UTSW 7 110821365 splice site probably benign
R4151:Rnf141 UTSW 7 110837199 missense probably benign 0.19
R4867:Rnf141 UTSW 7 110816768 missense probably damaging 1.00
R4869:Rnf141 UTSW 7 110825350 missense probably damaging 1.00
R4947:Rnf141 UTSW 7 110825320 missense possibly damaging 0.66
R5320:Rnf141 UTSW 7 110833803 missense probably damaging 1.00
R6364:Rnf141 UTSW 7 110821309 missense possibly damaging 0.75
R8492:Rnf141 UTSW 7 110837200 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGTTCAGCTACTCTCCCAAG -3'
(R):5'- TTGAGGTGACTGAATTCCCC -3'

Sequencing Primer
(F):5'- GAAACTCTTCGTAAGTTAAGGAGCC -3'
(R):5'- AGGCAAGCCTGTAGGTCATCTTC -3'
Posted On2020-07-13