Incidental Mutation 'R8219:Kcnn1'
ID636557
Institutional Source Beutler Lab
Gene Symbol Kcnn1
Ensembl Gene ENSMUSG00000002908
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
SynonymsSK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70842049-70863258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70852855 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 237 (Y237C)
Ref Sequence ENSEMBL: ENSMUSP00000105705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110078] [ENSMUST00000110081] [ENSMUST00000212086] [ENSMUST00000212243] [ENSMUST00000212414] [ENSMUST00000212509] [ENSMUST00000212611]
Predicted Effect probably damaging
Transcript: ENSMUST00000110078
AA Change: Y237C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105705
Gene: ENSMUSG00000002908
AA Change: Y237C

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 208 3.7e-59 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 275 369 9.6e-16 PFAM
CaMBD 382 461 1.99e-46 SMART
low complexity region 467 487 N/A INTRINSIC
low complexity region 507 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110081
AA Change: Y237C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105708
Gene: ENSMUSG00000002908
AA Change: Y237C

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 203 4.9e-51 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 274 368 1.7e-15 PFAM
CaMBD 382 462 3.71e-46 SMART
low complexity region 468 488 N/A INTRINSIC
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212084
Predicted Effect probably damaging
Transcript: ENSMUST00000212086
AA Change: Y280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212243
Predicted Effect probably benign
Transcript: ENSMUST00000212414
Predicted Effect probably benign
Transcript: ENSMUST00000212509
Predicted Effect probably damaging
Transcript: ENSMUST00000212611
AA Change: Y237C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. This gene is a member of the KCNN family of potassium channel genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal hippocampal morphology and afterhyperpolarization currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Kcnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kcnn1 APN 8 70848062 missense probably benign
IGL00498:Kcnn1 APN 8 70852880 missense probably damaging 1.00
IGL00792:Kcnn1 APN 8 70854716 missense probably benign 0.01
IGL03122:Kcnn1 APN 8 70855080 missense probably damaging 1.00
IGL03137:Kcnn1 APN 8 70850737 missense probably damaging 0.97
IGL03222:Kcnn1 APN 8 70848199 missense probably damaging 1.00
IGL03226:Kcnn1 APN 8 70846491 splice site probably benign
R0586:Kcnn1 UTSW 8 70863869 unclassified probably benign
R1218:Kcnn1 UTSW 8 70852688 missense probably benign 0.07
R1437:Kcnn1 UTSW 8 70844551 missense probably benign 0.03
R1510:Kcnn1 UTSW 8 70864070 unclassified probably benign
R2434:Kcnn1 UTSW 8 70855166 small deletion probably benign
R2860:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R2861:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R4327:Kcnn1 UTSW 8 70852663 missense probably damaging 0.99
R4807:Kcnn1 UTSW 8 70848178 missense probably damaging 0.99
R4947:Kcnn1 UTSW 8 70844429 missense probably benign 0.02
R5265:Kcnn1 UTSW 8 70854653 missense probably benign 0.07
R5685:Kcnn1 UTSW 8 70852730 missense probably damaging 1.00
R6108:Kcnn1 UTSW 8 70855156 missense probably benign 0.27
R6523:Kcnn1 UTSW 8 70846525 missense possibly damaging 0.57
R7512:Kcnn1 UTSW 8 70854649 missense possibly damaging 0.64
R8310:Kcnn1 UTSW 8 70852805 missense possibly damaging 0.83
R8809:Kcnn1 UTSW 8 70852653 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGGTTCAAGGACAGGACG -3'
(R):5'- TCTTGGTGGACAATGGTGCC -3'

Sequencing Primer
(F):5'- GTCGGTCACCTCTCACACACG -3'
(R):5'- ACAATGGTGCCGACGACTG -3'
Posted On2020-07-13