Incidental Mutation 'R8219:Tgm4'
ID 636563
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Name transglutaminase 4 (prostate)
Synonyms Eapa1, 9530008N10Rik, experimental autoimmune prostatitis antigen 1
MMRRC Submission 067659-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8219 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 122863806-122896623 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122874117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 119 (Y119F)
Ref Sequence ENSEMBL: ENSMUSP00000026893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026893
AA Change: Y119F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: Y119F

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,833,363 (GRCm39) S80T unknown Het
Acnat1 T A 4: 49,447,748 (GRCm39) I278F probably benign Het
Adgrf5 A T 17: 43,760,750 (GRCm39) Q815L probably benign Het
Aff1 T A 5: 103,994,199 (GRCm39) Y1022N probably damaging Het
Ahi1 A G 10: 20,950,335 (GRCm39) K1034E probably benign Het
Ano8 A T 8: 71,933,357 (GRCm39) L645Q unknown Het
Atg9b A G 5: 24,591,330 (GRCm39) L756P probably damaging Het
Atp2b2 A T 6: 113,770,811 (GRCm39) I411N probably damaging Het
Bmp6 T A 13: 38,529,963 (GRCm39) C19S unknown Het
Borcs5 A G 6: 134,621,313 (GRCm39) H27R probably benign Het
Cachd1 C A 4: 100,848,159 (GRCm39) D1091E probably benign Het
Ccdc186 T A 19: 56,781,777 (GRCm39) M801L probably benign Het
Clcn3 A T 8: 61,376,000 (GRCm39) M658K probably damaging Het
Col1a1 C T 11: 94,834,184 (GRCm39) R500C probably damaging Het
Cul4a T A 8: 13,196,540 (GRCm39) D731E possibly damaging Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
E2f7 T A 10: 110,595,704 (GRCm39) V133E probably damaging Het
Fam161b T C 12: 84,393,648 (GRCm39) E575G probably benign Het
Fubp1 T A 3: 151,926,103 (GRCm39) V275D probably damaging Het
Gabrg1 T A 5: 70,931,643 (GRCm39) R367* probably null Het
Gm6902 G A 7: 22,973,143 (GRCm39) A128V probably benign Het
Gnptab A G 10: 88,269,654 (GRCm39) T786A probably benign Het
Golga2 A G 2: 32,196,492 (GRCm39) N981D probably damaging Het
Gsap A T 5: 21,456,113 (GRCm39) I437L probably benign Het
Gulp1 A G 1: 44,793,501 (GRCm39) probably null Het
Kcnn1 T C 8: 71,305,499 (GRCm39) Y237C probably damaging Het
Klhl28 A T 12: 64,998,431 (GRCm39) N354K probably benign Het
Lama3 T C 18: 12,572,417 (GRCm39) Y541H probably benign Het
Lamc1 A G 1: 153,123,073 (GRCm39) Y706H probably damaging Het
Lima1 G T 15: 99,678,671 (GRCm39) T590K probably damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Mrgprb8 G A 7: 48,038,649 (GRCm39) V107M possibly damaging Het
Mrpl3 T A 9: 104,934,271 (GRCm39) N139K possibly damaging Het
Nhsl3 T A 4: 129,141,946 (GRCm39) D65V possibly damaging Het
Nudt16 T A 9: 105,007,636 (GRCm39) N161I probably damaging Het
Obscn G A 11: 59,013,574 (GRCm39) S1091L probably benign Het
Oog4 T C 4: 143,166,508 (GRCm39) M99V probably benign Het
Or5b105 A C 19: 13,080,284 (GRCm39) L122R probably damaging Het
Or8c16 A C 9: 38,130,668 (GRCm39) D183A probably damaging Het
Osbpl6 A T 2: 76,386,247 (GRCm39) D303V probably damaging Het
Pcdhb21 T C 18: 37,647,708 (GRCm39) F279S probably damaging Het
Peg3 G A 7: 6,711,364 (GRCm39) T1286I probably benign Het
Phax A G 18: 56,708,754 (GRCm39) N106S probably damaging Het
Pkdrej A G 15: 85,705,493 (GRCm39) Y148H probably damaging Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Ptprn2 C A 12: 117,148,357 (GRCm39) Q706K probably benign Het
Rdh11 T G 12: 79,235,880 (GRCm39) K23Q probably benign Het
Rit2 T A 18: 31,108,547 (GRCm39) E146V probably damaging Het
Rnf141 T C 7: 110,436,472 (GRCm39) probably benign Het
Sars1 T A 3: 108,352,378 (GRCm39) E24V probably benign Het
Sh3tc2 A G 18: 62,144,932 (GRCm39) I1129V probably benign Het
Slc10a5 G T 3: 10,400,384 (GRCm39) P92Q probably benign Het
Slc24a5 A T 2: 124,927,575 (GRCm39) probably null Het
Slc5a8 A G 10: 88,757,561 (GRCm39) Y517C probably damaging Het
Slc6a5 A G 7: 49,561,911 (GRCm39) M148V probably benign Het
Sorl1 T C 9: 41,952,857 (GRCm39) probably null Het
Tgm6 A G 2: 129,993,200 (GRCm39) K562R probably benign Het
Tlr3 T C 8: 45,851,016 (GRCm39) E627G possibly damaging Het
Tmprss11f A G 5: 86,677,878 (GRCm39) L297P probably damaging Het
Tpbgl T C 7: 99,274,978 (GRCm39) H293R probably benign Het
Trank1 A C 9: 111,193,977 (GRCm39) K667T probably damaging Het
Trpm1 A T 7: 63,851,699 (GRCm39) Q139L probably benign Het
Ttf2 T G 3: 100,869,879 (GRCm39) K398T possibly damaging Het
Xpa A T 4: 46,183,150 (GRCm39) M213K probably benign Het
Zmym2 T A 14: 57,163,316 (GRCm39) S623T probably benign Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 122,891,447 (GRCm39) unclassified probably benign
IGL01402:Tgm4 APN 9 122,880,519 (GRCm39) missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 122,885,531 (GRCm39) missense probably damaging 1.00
IGL02120:Tgm4 APN 9 122,875,594 (GRCm39) missense probably damaging 0.98
IGL03130:Tgm4 APN 9 122,885,580 (GRCm39) missense probably damaging 1.00
IGL03188:Tgm4 APN 9 122,874,101 (GRCm39) missense probably null 0.06
R0329:Tgm4 UTSW 9 122,877,622 (GRCm39) critical splice donor site probably null
R0480:Tgm4 UTSW 9 122,891,484 (GRCm39) missense probably benign
R0644:Tgm4 UTSW 9 122,880,523 (GRCm39) missense probably damaging 1.00
R0990:Tgm4 UTSW 9 122,875,576 (GRCm39) missense probably benign 0.02
R1604:Tgm4 UTSW 9 122,874,129 (GRCm39) missense probably benign 0.39
R1644:Tgm4 UTSW 9 122,880,481 (GRCm39) missense probably damaging 1.00
R2056:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2058:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2059:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2076:Tgm4 UTSW 9 122,880,160 (GRCm39) missense probably benign 0.24
R2437:Tgm4 UTSW 9 122,877,614 (GRCm39) nonsense probably null
R4392:Tgm4 UTSW 9 122,895,817 (GRCm39) missense probably benign 0.10
R4407:Tgm4 UTSW 9 122,885,595 (GRCm39) missense probably damaging 1.00
R4752:Tgm4 UTSW 9 122,880,451 (GRCm39) missense probably damaging 1.00
R5288:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5365:Tgm4 UTSW 9 122,895,866 (GRCm39) missense probably damaging 1.00
R5386:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5790:Tgm4 UTSW 9 122,890,808 (GRCm39) missense probably damaging 0.98
R5890:Tgm4 UTSW 9 122,890,703 (GRCm39) missense probably damaging 1.00
R6102:Tgm4 UTSW 9 122,885,600 (GRCm39) missense probably benign
R6358:Tgm4 UTSW 9 122,885,583 (GRCm39) missense probably damaging 1.00
R6956:Tgm4 UTSW 9 122,893,768 (GRCm39) missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 122,880,207 (GRCm39) missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 122,869,525 (GRCm39) missense probably damaging 1.00
R7258:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7313:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7369:Tgm4 UTSW 9 122,885,749 (GRCm39) critical splice donor site probably null
R7802:Tgm4 UTSW 9 122,880,401 (GRCm39) intron probably benign
R8787:Tgm4 UTSW 9 122,890,910 (GRCm39) missense probably damaging 1.00
R8936:Tgm4 UTSW 9 122,869,541 (GRCm39) missense possibly damaging 0.92
R9045:Tgm4 UTSW 9 122,877,616 (GRCm39) missense possibly damaging 0.94
R9328:Tgm4 UTSW 9 122,885,697 (GRCm39) missense possibly damaging 0.93
R9359:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9403:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9471:Tgm4 UTSW 9 122,869,444 (GRCm39) missense probably benign
R9746:Tgm4 UTSW 9 122,875,634 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCCAGAGAGAACGATTTGTTG -3'
(R):5'- AGGCATACACTAACTGTGCCTG -3'

Sequencing Primer
(F):5'- AACGATTTGTTGGGGCTGATGATTC -3'
(R):5'- ACTAACTGTGCCTGGTCATG -3'
Posted On 2020-07-13