Incidental Mutation 'R8219:Tgm4'
ID636563
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Nametransglutaminase 4 (prostate)
Synonyms9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123034726-123067561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123045052 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 119 (Y119F)
Ref Sequence ENSEMBL: ENSMUSP00000026893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893]
Predicted Effect probably benign
Transcript: ENSMUST00000026893
AA Change: Y119F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: Y119F

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 123062382 unclassified probably benign
IGL01402:Tgm4 APN 9 123051454 missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 123056466 missense probably damaging 1.00
IGL02120:Tgm4 APN 9 123046529 missense probably damaging 0.98
IGL03130:Tgm4 APN 9 123056515 missense probably damaging 1.00
IGL03188:Tgm4 APN 9 123045036 missense probably null 0.06
R0329:Tgm4 UTSW 9 123048557 critical splice donor site probably null
R0480:Tgm4 UTSW 9 123062419 missense probably benign
R0644:Tgm4 UTSW 9 123051458 missense probably damaging 1.00
R0990:Tgm4 UTSW 9 123046511 missense probably benign 0.02
R1604:Tgm4 UTSW 9 123045064 missense probably benign 0.39
R1644:Tgm4 UTSW 9 123051416 missense probably damaging 1.00
R2056:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2058:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2059:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2076:Tgm4 UTSW 9 123051095 missense probably benign 0.24
R2437:Tgm4 UTSW 9 123048549 nonsense probably null
R4392:Tgm4 UTSW 9 123066752 missense probably benign 0.10
R4407:Tgm4 UTSW 9 123056530 missense probably damaging 1.00
R4752:Tgm4 UTSW 9 123051386 missense probably damaging 1.00
R5288:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5365:Tgm4 UTSW 9 123066801 missense probably damaging 1.00
R5386:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5790:Tgm4 UTSW 9 123061743 missense probably damaging 0.98
R5890:Tgm4 UTSW 9 123061638 missense probably damaging 1.00
R6102:Tgm4 UTSW 9 123056535 missense probably benign
R6358:Tgm4 UTSW 9 123056518 missense probably damaging 1.00
R6956:Tgm4 UTSW 9 123064703 missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 123051142 missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 123040460 missense probably damaging 1.00
R7258:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7313:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7369:Tgm4 UTSW 9 123056684 critical splice donor site probably null
R7802:Tgm4 UTSW 9 123051336 intron probably benign
R8787:Tgm4 UTSW 9 123061845 missense probably damaging 1.00
R8936:Tgm4 UTSW 9 123040476 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCCAGAGAGAACGATTTGTTG -3'
(R):5'- AGGCATACACTAACTGTGCCTG -3'

Sequencing Primer
(F):5'- AACGATTTGTTGGGGCTGATGATTC -3'
(R):5'- ACTAACTGTGCCTGGTCATG -3'
Posted On2020-07-13