Incidental Mutation 'R8219:Bmp6'
ID636575
Institutional Source Beutler Lab
Gene Symbol Bmp6
Ensembl Gene ENSMUSG00000039004
Gene Namebone morphogenetic protein 6
SynonymsVgr1, D13Wsu115e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8219 (G1)
Quality Score108.008
Status Not validated
Chromosome13
Chromosomal Location38345107-38500302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38345987 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 19 (C19S)
Ref Sequence ENSEMBL: ENSMUSP00000126999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171970]
Predicted Effect unknown
Transcript: ENSMUST00000171970
AA Change: C19S
SMART Domains Protein: ENSMUSP00000126999
Gene: ENSMUSG00000039004
AA Change: C19S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 56 359 2.3e-100 PFAM
low complexity region 368 389 N/A INTRINSIC
TGFB 409 510 6.8e-71 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates a wide range of biological processes including iron homeostasis, fat and bone development, and ovulation. Mice lacking this gene exhibit delayed ossification of the sternum, iron overload, and reduced fertility in females. [provided by RefSeq, Jul 2016]
PHENOTYPE: One homozygous null mutant showed delayed ossification in the developing sternum while females of a second null mutant were smaller than normal in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Bmp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Bmp6 APN 13 38469634 missense probably damaging 0.99
IGL01409:Bmp6 APN 13 38485889 missense probably damaging 1.00
IGL01646:Bmp6 APN 13 38498928 missense probably damaging 0.99
IGL01823:Bmp6 APN 13 38498822 missense probably damaging 1.00
IGL03000:Bmp6 APN 13 38498911 splice site probably benign
IGL03337:Bmp6 APN 13 38498943 missense probably damaging 1.00
PIT4431001:Bmp6 UTSW 13 38485930 missense probably benign
R1218:Bmp6 UTSW 13 38346250 small deletion probably benign
R1225:Bmp6 UTSW 13 38346281 missense probably benign
R4579:Bmp6 UTSW 13 38469725 missense probably damaging 1.00
R4834:Bmp6 UTSW 13 38485841 missense probably damaging 1.00
R5208:Bmp6 UTSW 13 38469697 missense probably benign 0.23
R5713:Bmp6 UTSW 13 38498952 missense probably damaging 1.00
R5842:Bmp6 UTSW 13 38346567 missense probably damaging 0.99
R6319:Bmp6 UTSW 13 38346414 missense probably benign 0.28
R7348:Bmp6 UTSW 13 38485903 missense probably benign 0.00
R7565:Bmp6 UTSW 13 38346257 nonsense probably null
R7669:Bmp6 UTSW 13 38484920 missense probably damaging 0.98
R7681:Bmp6 UTSW 13 38346195 missense probably damaging 1.00
R7834:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
R8842:Bmp6 UTSW 13 38346383 missense probably benign 0.24
R8842:Bmp6 UTSW 13 38498819 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCCTACAAGCCAGGAGAG -3'
(R):5'- ACCGACAGGATCTCCTTTTGC -3'

Sequencing Primer
(F):5'- AGACTGCGAGTGACCGTG -3'
(R):5'- GACAGGATCTCCTTTTGCATCTC -3'
Posted On2020-07-13