Incidental Mutation 'R8219:Pkdrej'
ID636577
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85821292 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 148 (Y148H)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably damaging
Transcript: ENSMUST00000064370
AA Change: Y148H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: Y148H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 splice site probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R8121:Pkdrej UTSW 15 85815454 missense probably benign 0.00
R8140:Pkdrej UTSW 15 85818410 missense probably damaging 1.00
R8222:Pkdrej UTSW 15 85817439 missense probably benign
R8432:Pkdrej UTSW 15 85817293 missense probably benign 0.00
R8755:Pkdrej UTSW 15 85819606 missense probably benign 0.00
R8786:Pkdrej UTSW 15 85819843 missense probably benign 0.01
R8817:Pkdrej UTSW 15 85818573 missense probably damaging 1.00
R8827:Pkdrej UTSW 15 85815531 missense possibly damaging 0.76
Z1177:Pkdrej UTSW 15 85816537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATATCCGAGCCTGTCACC -3'
(R):5'- CTCCTGAAAGTCAACTCTTCGG -3'

Sequencing Primer
(F):5'- GAGCCTGTCACCGTGGG -3'
(R):5'- TGAAAGTCAACTCTTCGGACCCC -3'
Posted On2020-07-13