Incidental Mutation 'R8219:Lama3'
ID636580
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Namelaminin, alpha 3
Synonyms[a]3B, nicein, 150kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location12333819-12583013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12439360 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 541 (Y541H)
Ref Sequence ENSEMBL: ENSMUSP00000089703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070]
Predicted Effect probably benign
Transcript: ENSMUST00000092070
AA Change: Y541H

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: Y541H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 splice site probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7026:Lama3 UTSW 18 12516548 missense probably damaging 0.98
R7088:Lama3 UTSW 18 12582545 missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12582644 missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12552813 missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12531879 missense probably benign 0.00
R7121:Lama3 UTSW 18 12462782 missense probably benign 0.06
R7133:Lama3 UTSW 18 12539786 missense probably benign 0.05
R7150:Lama3 UTSW 18 12468289 missense probably damaging 1.00
R7158:Lama3 UTSW 18 12456812 missense probably benign 0.20
R7170:Lama3 UTSW 18 12404076 missense probably benign 0.26
R7216:Lama3 UTSW 18 12430000 missense probably damaging 1.00
R7223:Lama3 UTSW 18 12582608 missense possibly damaging 0.53
R7243:Lama3 UTSW 18 12419845 missense probably damaging 1.00
R7282:Lama3 UTSW 18 12439392 missense probably damaging 0.99
R7337:Lama3 UTSW 18 12507040 splice site probably null
R7442:Lama3 UTSW 18 12472181 critical splice acceptor site probably null
R7487:Lama3 UTSW 18 12419237 missense probably benign
R7604:Lama3 UTSW 18 12500493 missense possibly damaging 0.93
R7609:Lama3 UTSW 18 12531834 critical splice acceptor site probably null
R7650:Lama3 UTSW 18 12537838 missense probably benign 0.01
R7894:Lama3 UTSW 18 12462807 missense probably benign 0.07
R7975:Lama3 UTSW 18 12537739 missense probably damaging 1.00
R8099:Lama3 UTSW 18 12534063 missense probably damaging 0.97
R8168:Lama3 UTSW 18 12506942 missense probably null
R8227:Lama3 UTSW 18 12407551 missense probably benign
R8229:Lama3 UTSW 18 12407551 missense probably benign
R8298:Lama3 UTSW 18 12525853 missense probably benign 0.12
R8351:Lama3 UTSW 18 12540613 missense probably damaging 1.00
R8364:Lama3 UTSW 18 12528347 missense probably damaging 0.99
R8463:Lama3 UTSW 18 12449839 missense probably damaging 0.96
R8515:Lama3 UTSW 18 12411631 missense probably null 0.01
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Z1177:Lama3 UTSW 18 12429879 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTAGAAGCCAGGATTAGCCC -3'
(R):5'- ATGTAGAGAAGACTCACCAGGC -3'

Sequencing Primer
(F):5'- CCAGGATTAGCCCCATGTAAGG -3'
(R):5'- AGGCTTCTCCAAGAGGTCAG -3'
Posted On2020-07-13