Incidental Mutation 'R8219:Pcdhb21'
ID636582
Institutional Source Beutler Lab
Gene Symbol Pcdhb21
Ensembl Gene ENSMUSG00000044022
Gene Nameprotocadherin beta 21
SynonymsPcdhb18, PcdhbU
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37513621-37518325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37514655 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 279 (F279S)
Ref Sequence ENSEMBL: ENSMUSP00000056424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000061405
AA Change: F279S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022
AA Change: F279S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097609
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192409
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Pcdhb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pcdhb21 APN 18 37514553 missense probably damaging 1.00
IGL01860:Pcdhb21 APN 18 37514905 missense probably benign 0.00
IGL02139:Pcdhb21 APN 18 37515246 missense probably damaging 1.00
IGL02370:Pcdhb21 APN 18 37514592 splice site probably null
IGL03108:Pcdhb21 APN 18 37515891 splice site probably null
IGL03265:Pcdhb21 APN 18 37515153 missense probably damaging 1.00
R0454:Pcdhb21 UTSW 18 37514513 missense probably damaging 1.00
R0519:Pcdhb21 UTSW 18 37516032 missense possibly damaging 0.95
R0647:Pcdhb21 UTSW 18 37513860 missense probably damaging 0.99
R0689:Pcdhb21 UTSW 18 37515317 missense probably benign 0.00
R1607:Pcdhb21 UTSW 18 37515479 missense probably damaging 1.00
R1649:Pcdhb21 UTSW 18 37515613 missense probably damaging 1.00
R1777:Pcdhb21 UTSW 18 37515718 missense possibly damaging 0.80
R1865:Pcdhb21 UTSW 18 37514595 missense possibly damaging 0.95
R4595:Pcdhb21 UTSW 18 37514515 missense probably damaging 1.00
R4888:Pcdhb21 UTSW 18 37515077 missense possibly damaging 0.76
R5281:Pcdhb21 UTSW 18 37513935 missense probably benign 0.00
R5396:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5398:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5399:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5635:Pcdhb21 UTSW 18 37513917 missense probably benign 0.33
R6134:Pcdhb21 UTSW 18 37514408 missense probably benign 0.03
R6387:Pcdhb21 UTSW 18 37515332 missense probably benign 0.35
R6595:Pcdhb21 UTSW 18 37515908 missense probably damaging 1.00
R6750:Pcdhb21 UTSW 18 37514448 missense probably damaging 1.00
R6754:Pcdhb21 UTSW 18 37514683 missense probably benign 0.28
R6928:Pcdhb21 UTSW 18 37514421 missense probably damaging 1.00
R7420:Pcdhb21 UTSW 18 37515203 missense probably damaging 1.00
R7503:Pcdhb21 UTSW 18 37514975 missense probably benign 0.07
R8164:Pcdhb21 UTSW 18 37516004 missense probably benign 0.32
R8271:Pcdhb21 UTSW 18 37515868 missense probably benign 0.00
R8336:Pcdhb21 UTSW 18 37515889 nonsense probably null
R8442:Pcdhb21 UTSW 18 37513788 intron probably benign
R8678:Pcdhb21 UTSW 18 37514886 missense probably damaging 1.00
Z1088:Pcdhb21 UTSW 18 37514541 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCTATGGATGGTGGGTC -3'
(R):5'- CTGGTGGGTTGTCATTCACATC -3'

Sequencing Primer
(F):5'- CTATGGATGGTGGGTCCCTGC -3'
(R):5'- CTGTAACCTGGACAATAATGGCTG -3'
Posted On2020-07-13