Incidental Mutation 'R8219:Phax'
ID636583
Institutional Source Beutler Lab
Gene Symbol Phax
Ensembl Gene ENSMUSG00000008301
Gene Namephosphorylated adaptor for RNA export
SynonymsD18Ertd65e, p55, Phax, phosphorylation regulated, Rnuxa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location56562443-56587712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56575682 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 106 (N106S)
Ref Sequence ENSEMBL: ENSMUSP00000008445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008445] [ENSMUST00000130163] [ENSMUST00000174518]
Predicted Effect probably damaging
Transcript: ENSMUST00000008445
AA Change: N106S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008445
Gene: ENSMUSG00000008301
AA Change: N106S

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 81 91 N/A INTRINSIC
low complexity region 145 153 N/A INTRINSIC
Pfam:RNA_GG_bind 221 304 2.4e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130163
AA Change: N84S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122948
Gene: ENSMUSG00000008301
AA Change: N84S

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
low complexity region 123 131 N/A INTRINSIC
Pfam:RNA_GG_bind 199 282 2.7e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132628
AA Change: N88S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119047
Gene: ENSMUSG00000008301
AA Change: N88S

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
low complexity region 64 74 N/A INTRINSIC
low complexity region 128 136 N/A INTRINSIC
Pfam:RNA_GG_bind 204 251 3.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174518
SMART Domains Protein: ENSMUSP00000133372
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 31 494 7.3e-130 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Phax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02622:Phax APN 18 56584300 nonsense probably null
IGL03179:Phax APN 18 56580292 missense probably damaging 1.00
R0103:Phax UTSW 18 56562713 missense probably benign 0.16
R1869:Phax UTSW 18 56573104 missense probably benign 0.00
R2507:Phax UTSW 18 56586884 missense probably damaging 0.96
R2974:Phax UTSW 18 56573062 missense probably benign 0.09
R4079:Phax UTSW 18 56575979 missense possibly damaging 0.92
R4945:Phax UTSW 18 56575991 missense probably damaging 0.99
R5526:Phax UTSW 18 56584310 missense probably damaging 1.00
R5988:Phax UTSW 18 56575492 missense probably benign 0.03
R5990:Phax UTSW 18 56575603 missense probably benign
R6341:Phax UTSW 18 56573101 missense possibly damaging 0.85
R6524:Phax UTSW 18 56587002 missense probably damaging 0.99
R7521:Phax UTSW 18 56575918 nonsense probably null
Z1176:Phax UTSW 18 56586952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGACTGTTAAACATGTGGACTC -3'
(R):5'- AGGTGACCTTGCCCATTCTC -3'

Sequencing Primer
(F):5'- CTGTTAAACATGTGGACTCCAGCG -3'
(R):5'- TTGTCACCATGCATATATTCATCTAG -3'
Posted On2020-07-13