Incidental Mutation 'R8220:Nup43'
ID636633
Institutional Source Beutler Lab
Gene Symbol Nup43
Ensembl Gene ENSMUSG00000040034
Gene Namenucleoporin 43
Synonymsp42, 43kDa, 2610529I12Rik, 2610016K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R8220 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location7667503-7678881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7676333 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 295 (A295V)
Ref Sequence ENSEMBL: ENSMUSP00000046732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040135] [ENSMUST00000159977] [ENSMUST00000162682] [ENSMUST00000165952]
Predicted Effect probably benign
Transcript: ENSMUST00000040135
AA Change: A295V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046732
Gene: ENSMUSG00000040034
AA Change: A295V

DomainStartEndE-ValueType
Blast:WD40 1 48 1e-15 BLAST
WD40 64 101 3.57e0 SMART
WD40 124 157 2.45e2 SMART
WD40 160 199 9.55e0 SMART
WD40 206 246 2.15e-4 SMART
WD40 250 290 2.19e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159977
Predicted Effect probably benign
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165952
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bidirectional transport of macromolecules between the cytoplasm and nucleus occurs through nuclear pore complexes (NPCs) embedded in the nuclear envelope. NPCs are composed of subcomplexes, and NUP43 is part of one such subcomplex, Nup107-160 (Loiodice et al., 2004 [PubMed 15146057]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,835 C106S probably damaging Het
4930427A07Rik T C 12: 113,156,755 probably null Het
7420426K07Rik A G 9: 98,903,528 D82G probably benign Het
Abca13 C T 11: 9,434,299 T3917M possibly damaging Het
Abcb8 T C 5: 24,406,785 I533T possibly damaging Het
Becn1 C T 11: 101,296,279 R78Q possibly damaging Het
Bhlha9 T C 11: 76,672,877 I110T probably damaging Het
Cemip T C 7: 83,947,160 D1132G probably damaging Het
Dcpp2 A G 17: 23,900,692 E160G possibly damaging Het
Dock10 C T 1: 80,528,649 G1726S probably null Het
Dsel T C 1: 111,861,707 D366G probably damaging Het
Ednrb A T 14: 103,821,705 L295Q probably damaging Het
Etaa1 C T 11: 17,945,690 R809K probably benign Het
Fahd1 A G 17: 24,849,890 L71P probably damaging Het
Fat1 A G 8: 45,039,956 E3882G probably null Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gba2 T G 4: 43,568,510 D652A probably damaging Het
Gm15448 T C 7: 3,822,904 E322G unknown Het
Gm5460 C T 14: 34,045,919 P220S probably damaging Het
Gm7137 A T 10: 77,787,951 C84S unknown Het
Hist1h1e T C 13: 23,621,939 S187G probably benign Het
Hyal5 A T 6: 24,876,880 I251L probably benign Het
Igf2r A T 17: 12,692,071 S1953R probably benign Het
Igkc C A 6: 70,726,682 N82K Het
Il18 T A 9: 50,575,316 M15K possibly damaging Het
Insr T A 8: 3,158,702 E1253V probably benign Het
Itgax A G 7: 128,130,918 Q82R probably benign Het
Kcnn3 A G 3: 89,661,241 I609V probably benign Het
Klk14 A G 7: 43,694,074 D110G probably damaging Het
Lamb3 T A 1: 193,334,248 L679Q probably damaging Het
Lgsn C T 1: 31,196,800 A115V probably benign Het
Lipt1 C T 1: 37,875,625 T254M probably damaging Het
Lrrc3b T C 14: 15,358,004 T201A probably damaging Het
Lrrc49 T A 9: 60,610,330 D432V probably benign Het
Mfi2 A G 16: 31,887,415 N239S probably benign Het
Mki67 G A 7: 135,698,121 A1728V probably benign Het
Mms22l T A 4: 24,536,375 L615I probably damaging Het
Mttp C A 3: 138,123,848 G93V probably benign Het
Muc4 A T 16: 32,755,327 T1734S unknown Het
Myh9 C T 15: 77,764,547 R1703Q possibly damaging Het
N4bp1 T C 8: 86,844,687 *894W probably null Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Olfr1047 C T 2: 86,228,965 G2E probably benign Het
Olfr1158 C T 2: 87,990,152 L14F probably damaging Het
Olfr1271 T C 2: 90,266,043 H129R probably benign Het
Olfr366 T C 2: 37,219,779 C97R probably benign Het
Olfr851 G T 9: 19,497,021 S91I probably damaging Het
Pcdha11 A G 18: 37,006,571 T418A probably benign Het
Pdzd2 T C 15: 12,592,163 K132E probably damaging Het
Plec C T 15: 76,178,297 R2480H possibly damaging Het
Plscr2 G A 9: 92,295,660 G293D probably damaging Het
Ptchd4 A G 17: 42,502,663 H485R probably benign Het
Rbbp9 A T 2: 144,548,066 M59K probably null Het
Rest G A 5: 77,282,478 A915T probably benign Het
Rhbdf1 C T 11: 32,214,563 A168T probably benign Het
Scamp2 A T 9: 57,577,670 Q53L probably benign Het
Scn2a1 T C 2: 65,690,276 F539L probably benign Het
Sdr16c6 A T 4: 4,076,872 I9N probably benign Het
Slc23a3 T A 1: 75,133,867 probably benign Het
Slc6a19 A G 13: 73,685,770 S390P probably damaging Het
Snx11 C T 11: 96,771,059 R99Q probably damaging Het
Soga3 C T 10: 29,147,268 Q204* probably null Het
Suclg2 T A 6: 95,588,946 I189F possibly damaging Het
Timeless A T 10: 128,246,396 R598W probably damaging Het
Tm9sf3 A T 19: 41,215,087 N583K possibly damaging Het
Tox3 A G 8: 90,258,080 V157A probably damaging Het
Tpr G T 1: 150,432,413 V1640L probably benign Het
Trav7-4 C T 14: 53,461,645 A83V probably benign Het
Trdn A G 10: 33,450,985 K590R possibly damaging Het
Trim11 T C 11: 58,990,394 L371P probably damaging Het
Trim5 T A 7: 104,276,826 Q176L probably damaging Het
Tubgcp2 T C 7: 140,006,140 H412R possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Ush2a T A 1: 188,728,666 V2708E probably damaging Het
Vmn1r87 T A 7: 13,131,500 T287S possibly damaging Het
Zbtb7a A G 10: 81,145,004 D344G probably damaging Het
Zfp560 G T 9: 20,349,052 N171K probably benign Het
Zfp579 A T 7: 4,993,851 C354S probably benign Het
Other mutations in Nup43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Nup43 APN 10 7669556 missense probably benign
IGL02029:Nup43 APN 10 7667583 missense possibly damaging 0.87
IGL02375:Nup43 APN 10 7673594 missense probably damaging 1.00
R0413:Nup43 UTSW 10 7671027 missense probably benign 0.05
R1061:Nup43 UTSW 10 7667671 missense probably damaging 0.99
R1892:Nup43 UTSW 10 7673609 missense probably damaging 0.99
R2960:Nup43 UTSW 10 7670949 missense probably benign
R3551:Nup43 UTSW 10 7675014 missense possibly damaging 0.93
R4772:Nup43 UTSW 10 7678669 nonsense probably null
R6179:Nup43 UTSW 10 7678673 missense probably benign 0.40
R6346:Nup43 UTSW 10 7675062 missense probably damaging 1.00
R8073:Nup43 UTSW 10 7670949 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGTAAGGGCCACTACTTGTG -3'
(R):5'- TAACTCCTGAGAATGTTCAAGCTAG -3'

Sequencing Primer
(F):5'- CTTGTGGGTAGGCCATAAAATAACC -3'
(R):5'- TCCTGAGAATGTTCAAGCTAGAGATG -3'
Posted On2020-07-13