Incidental Mutation 'R8220:Rhbdf1'
ID 636642
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Name rhomboid 5 homolog 1
Synonyms Dist, Dist1, Egfr-rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R8220 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 32209585-32222300 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32214563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 168 (A168T)
Ref Sequence ENSEMBL: ENSMUSP00000020524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000144902] [ENSMUST00000146179] [ENSMUST00000150381]
AlphaFold Q6PIX5
Predicted Effect probably benign
Transcript: ENSMUST00000020524
AA Change: A168T

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: A168T

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143988
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144902
SMART Domains Protein: ENSMUSP00000122533
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,835 C106S probably damaging Het
4930427A07Rik T C 12: 113,156,755 probably null Het
7420426K07Rik A G 9: 98,903,528 D82G probably benign Het
Abca13 C T 11: 9,434,299 T3917M possibly damaging Het
Abcb8 T C 5: 24,406,785 I533T possibly damaging Het
Becn1 C T 11: 101,296,279 R78Q possibly damaging Het
Bhlha9 T C 11: 76,672,877 I110T probably damaging Het
Cemip T C 7: 83,947,160 D1132G probably damaging Het
Cyth3 T A 5: 143,701,589 probably null Het
Dcpp2 A G 17: 23,900,692 E160G possibly damaging Het
Dock10 C T 1: 80,528,649 G1726S probably null Het
Dsel T C 1: 111,861,707 D366G probably damaging Het
Ednrb A T 14: 103,821,705 L295Q probably damaging Het
Etaa1 C T 11: 17,945,690 R809K probably benign Het
Fahd1 A G 17: 24,849,890 L71P probably damaging Het
Fat1 A G 8: 45,039,956 E3882G probably null Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gba2 T G 4: 43,568,510 D652A probably damaging Het
Gm15448 T C 7: 3,822,904 E322G unknown Het
Gm5460 C T 14: 34,045,919 P220S probably damaging Het
Gm7137 A T 10: 77,787,951 C84S unknown Het
Gm8122 G T 14: 43,232,717 probably null Het
Hist1h1e T C 13: 23,621,939 S187G probably benign Het
Hyal5 A T 6: 24,876,880 I251L probably benign Het
Igf2r A T 17: 12,692,071 S1953R probably benign Het
Igkc C A 6: 70,726,682 N82K Het
Il18 T A 9: 50,575,316 M15K possibly damaging Het
Insr T A 8: 3,158,702 E1253V probably benign Het
Itgax A G 7: 128,130,918 Q82R probably benign Het
Kcnn3 A G 3: 89,661,241 I609V probably benign Het
Klk14 A G 7: 43,694,074 D110G probably damaging Het
Lamb3 T A 1: 193,334,248 L679Q probably damaging Het
Lgsn C T 1: 31,196,800 A115V probably benign Het
Lipt1 C T 1: 37,875,625 T254M probably damaging Het
Lrrc3b T C 14: 15,358,004 T201A probably damaging Het
Lrrc49 T A 9: 60,610,330 D432V probably benign Het
Mfi2 A G 16: 31,887,415 N239S probably benign Het
Mki67 G A 7: 135,698,121 A1728V probably benign Het
Mms22l T A 4: 24,536,375 L615I probably damaging Het
Mttp C A 3: 138,123,848 G93V probably benign Het
Muc4 A T 16: 32,755,327 T1734S unknown Het
Myh9 C T 15: 77,764,547 R1703Q possibly damaging Het
N4bp1 T C 8: 86,844,687 *894W probably null Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Nup43 C T 10: 7,676,333 A295V probably benign Het
Olfr1047 C T 2: 86,228,965 G2E probably benign Het
Olfr1158 C T 2: 87,990,152 L14F probably damaging Het
Olfr1271 T C 2: 90,266,043 H129R probably benign Het
Olfr366 T C 2: 37,219,779 C97R probably benign Het
Olfr851 G T 9: 19,497,021 S91I probably damaging Het
Pcdha11 A G 18: 37,006,571 T418A probably benign Het
Pdzd2 T C 15: 12,592,163 K132E probably damaging Het
Plec C T 15: 76,178,297 R2480H possibly damaging Het
Plscr2 G A 9: 92,295,660 G293D probably damaging Het
Ptchd4 A G 17: 42,502,663 H485R probably benign Het
Rbbp9 A T 2: 144,548,066 M59K probably null Het
Rest G A 5: 77,282,478 A915T probably benign Het
Scamp2 A T 9: 57,577,670 Q53L probably benign Het
Scn2a1 T C 2: 65,690,276 F539L probably benign Het
Sdr16c6 A T 4: 4,076,872 I9N probably benign Het
Slc23a3 T A 1: 75,133,867 probably benign Het
Slc6a19 A G 13: 73,685,770 S390P probably damaging Het
Snx11 C T 11: 96,771,059 R99Q probably damaging Het
Soga3 C T 10: 29,147,268 Q204* probably null Het
Suclg2 T A 6: 95,588,946 I189F possibly damaging Het
Timeless A T 10: 128,246,396 R598W probably damaging Het
Tm9sf3 A T 19: 41,215,087 N583K possibly damaging Het
Tox3 A G 8: 90,258,080 V157A probably damaging Het
Tpr G T 1: 150,432,413 V1640L probably benign Het
Trav7-4 C T 14: 53,461,645 A83V probably benign Het
Trdn A G 10: 33,450,985 K590R possibly damaging Het
Trim11 T C 11: 58,990,394 L371P probably damaging Het
Trim5 T A 7: 104,276,826 Q176L probably damaging Het
Tubgcp2 T C 7: 140,006,140 H412R possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Ush2a T A 1: 188,728,666 V2708E probably damaging Het
Vmn1r87 T A 7: 13,131,500 T287S possibly damaging Het
Zbtb7a A G 10: 81,145,004 D344G probably damaging Het
Zfp560 G T 9: 20,349,052 N171K probably benign Het
Zfp579 A T 7: 4,993,851 C354S probably benign Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
BB005:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
BB015:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 splice site probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 splice site probably null
R5728:Rhbdf1 UTSW 11 32209901 splice site probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
R7928:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
R7940:Rhbdf1 UTSW 11 32216258 start codon destroyed possibly damaging 0.79
R7957:Rhbdf1 UTSW 11 32210523 missense probably damaging 1.00
R8490:Rhbdf1 UTSW 11 32210162 missense probably damaging 0.98
R8939:Rhbdf1 UTSW 11 32210093 missense probably benign 0.00
R9040:Rhbdf1 UTSW 11 32213063 missense probably benign 0.23
R9257:Rhbdf1 UTSW 11 32210754 missense probably benign 0.00
R9509:Rhbdf1 UTSW 11 32215055 missense possibly damaging 0.96
R9575:Rhbdf1 UTSW 11 32213101 missense probably benign 0.00
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTGCACTCAGTTTCCACAC -3'
(R):5'- GTCATGGTATTGTTCTAGTGCAGAC -3'

Sequencing Primer
(F):5'- GTTTCCACACCTACAACCTCGG -3'
(R):5'- CTAGTGCAGACTCTGAATTTCAAGGG -3'
Posted On 2020-07-13