Incidental Mutation 'R8220:Ednrb'
ID 636653
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission 067638-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R8220 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104059141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 295 (L295Q)
Ref Sequence ENSEMBL: ENSMUSP00000022718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237]
AlphaFold P48302
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: L295Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: L295Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: L295Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: L295Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,570,723 (GRCm39) C106S probably damaging Het
Abca13 C T 11: 9,384,299 (GRCm39) T3917M possibly damaging Het
Abcb8 T C 5: 24,611,783 (GRCm39) I533T possibly damaging Het
Becn1 C T 11: 101,187,105 (GRCm39) R78Q possibly damaging Het
Bhlha9 T C 11: 76,563,703 (GRCm39) I110T probably damaging Het
Cemip T C 7: 83,596,368 (GRCm39) D1132G probably damaging Het
Cyth3 T A 5: 143,687,344 (GRCm39) probably null Het
Dcpp2 A G 17: 24,119,666 (GRCm39) E160G possibly damaging Het
Dock10 C T 1: 80,506,366 (GRCm39) G1726S probably null Het
Dsel T C 1: 111,789,437 (GRCm39) D366G probably damaging Het
Etaa1 C T 11: 17,895,690 (GRCm39) R809K probably benign Het
Fahd1 A G 17: 25,068,864 (GRCm39) L71P probably damaging Het
Fat1 A G 8: 45,492,993 (GRCm39) E3882G probably null Het
Frem2 A T 3: 53,563,928 (GRCm39) L193* probably null Het
Gba2 T G 4: 43,568,510 (GRCm39) D652A probably damaging Het
Gm5460 C T 14: 33,767,876 (GRCm39) P220S probably damaging Het
Gm7137 A T 10: 77,623,785 (GRCm39) C84S unknown Het
Gm8122 G T 14: 43,090,174 (GRCm39) probably null Het
H1f4 T C 13: 23,805,922 (GRCm39) S187G probably benign Het
Hyal5 A T 6: 24,876,879 (GRCm39) I251L probably benign Het
Igf2r A T 17: 12,910,958 (GRCm39) S1953R probably benign Het
Igkc C A 6: 70,703,666 (GRCm39) N82K Het
Il18 T A 9: 50,486,616 (GRCm39) M15K possibly damaging Het
Insr T A 8: 3,208,702 (GRCm39) E1253V probably benign Het
Itgax A G 7: 127,730,090 (GRCm39) Q82R probably benign Het
Kcnn3 A G 3: 89,568,548 (GRCm39) I609V probably benign Het
Klk14 A G 7: 43,343,498 (GRCm39) D110G probably damaging Het
Lamb3 T A 1: 193,016,556 (GRCm39) L679Q probably damaging Het
Lgsn C T 1: 31,235,881 (GRCm39) A115V probably benign Het
Lipt1 C T 1: 37,914,706 (GRCm39) T254M probably damaging Het
Lrrc3b T C 14: 15,358,004 (GRCm38) T201A probably damaging Het
Lrrc49 T A 9: 60,517,613 (GRCm39) D432V probably benign Het
Meltf A G 16: 31,706,233 (GRCm39) N239S probably benign Het
Mki67 G A 7: 135,299,850 (GRCm39) A1728V probably benign Het
Mms22l T A 4: 24,536,375 (GRCm39) L615I probably damaging Het
Mtcl3 C T 10: 29,023,264 (GRCm39) Q204* probably null Het
Mttp C A 3: 137,829,609 (GRCm39) G93V probably benign Het
Muc4 A T 16: 32,575,701 (GRCm39) T1734S unknown Het
Myh9 C T 15: 77,648,747 (GRCm39) R1703Q possibly damaging Het
N4bp1 T C 8: 87,571,315 (GRCm39) *894W probably null Het
Nab2 C A 10: 127,498,645 (GRCm39) V475L probably benign Het
Nup43 C T 10: 7,552,097 (GRCm39) A295V probably benign Het
Or1af1 T C 2: 37,109,791 (GRCm39) C97R probably benign Het
Or4b12 T C 2: 90,096,387 (GRCm39) H129R probably benign Het
Or7g32 G T 9: 19,408,317 (GRCm39) S91I probably damaging Het
Or8k3 C T 2: 86,059,309 (GRCm39) G2E probably benign Het
Or9m2 C T 2: 87,820,496 (GRCm39) L14F probably damaging Het
Pcdha11 A G 18: 37,139,624 (GRCm39) T418A probably benign Het
Pdzd2 T C 15: 12,592,249 (GRCm39) K132E probably damaging Het
Pira13 T C 7: 3,825,903 (GRCm39) E322G unknown Het
Plec C T 15: 76,062,497 (GRCm39) R2480H possibly damaging Het
Plscr2 G A 9: 92,177,713 (GRCm39) G293D probably damaging Het
Prr23a4 A G 9: 98,785,581 (GRCm39) D82G probably benign Het
Ptchd4 A G 17: 42,813,554 (GRCm39) H485R probably benign Het
Rbbp9 A T 2: 144,389,986 (GRCm39) M59K probably null Het
Rest G A 5: 77,430,325 (GRCm39) A915T probably benign Het
Rhbdf1 C T 11: 32,164,563 (GRCm39) A168T probably benign Het
Scamp2 A T 9: 57,484,953 (GRCm39) Q53L probably benign Het
Scn2a T C 2: 65,520,620 (GRCm39) F539L probably benign Het
Sdr16c6 A T 4: 4,076,872 (GRCm39) I9N probably benign Het
Slc23a3 T A 1: 75,110,511 (GRCm39) probably benign Het
Slc6a19 A G 13: 73,833,889 (GRCm39) S390P probably damaging Het
Snx11 C T 11: 96,661,885 (GRCm39) R99Q probably damaging Het
Suclg2 T A 6: 95,565,927 (GRCm39) I189F possibly damaging Het
Tedc1 T C 12: 113,120,375 (GRCm39) probably null Het
Timeless A T 10: 128,082,265 (GRCm39) R598W probably damaging Het
Tm9sf3 A T 19: 41,203,526 (GRCm39) N583K possibly damaging Het
Tox3 A G 8: 90,984,708 (GRCm39) V157A probably damaging Het
Tpr G T 1: 150,308,164 (GRCm39) V1640L probably benign Het
Trav7-4 C T 14: 53,699,102 (GRCm39) A83V probably benign Het
Trdn A G 10: 33,326,981 (GRCm39) K590R possibly damaging Het
Trim11 T C 11: 58,881,220 (GRCm39) L371P probably damaging Het
Trim5 T A 7: 103,926,033 (GRCm39) Q176L probably damaging Het
Tubgcp2 T C 7: 139,586,053 (GRCm39) H412R possibly damaging Het
Ugt2b35 T A 5: 87,149,302 (GRCm39) S184R probably damaging Het
Ush2a T A 1: 188,460,863 (GRCm39) V2708E probably damaging Het
Vmn1r87 T A 7: 12,865,427 (GRCm39) T287S possibly damaging Het
Zbtb7a A G 10: 80,980,838 (GRCm39) D344G probably damaging Het
Zfp560 G T 9: 20,260,348 (GRCm39) N171K probably benign Het
Zfp579 A T 7: 4,996,850 (GRCm39) C354S probably benign Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2118:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R2852:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R3708:Ednrb UTSW 14 104,054,516 (GRCm39) missense probably damaging 1.00
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5626:Ednrb UTSW 14 104,080,564 (GRCm39) missense probably damaging 0.98
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5802:Ednrb UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8299:Ednrb UTSW 14 104,060,936 (GRCm39) missense probably damaging 1.00
R8375:Ednrb UTSW 14 104,057,383 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9546:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTAATCGAGATTCCATCTTAAAAGG -3'
(R):5'- AGTAGATATGGCCCACGAAAC -3'

Sequencing Primer
(F):5'- CAACAACAAAAGTCAATGATTCTCTC -3'
(R):5'- TAGATATGGCCCACGAAACCCTATAC -3'
Posted On 2020-07-13