Incidental Mutation 'R8220:Igf2r'
ID636660
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Nameinsulin-like growth factor 2 receptor
SynonymsM6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R8220 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location12682406-12769664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12692071 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1953 (S1953R)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
Predicted Effect probably benign
Transcript: ENSMUST00000024599
AA Change: S1953R

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: S1953R

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,835 C106S probably damaging Het
4930427A07Rik T C 12: 113,156,755 probably null Het
7420426K07Rik A G 9: 98,903,528 D82G probably benign Het
Abca13 C T 11: 9,434,299 T3917M possibly damaging Het
Abcb8 T C 5: 24,406,785 I533T possibly damaging Het
Becn1 C T 11: 101,296,279 R78Q possibly damaging Het
Bhlha9 T C 11: 76,672,877 I110T probably damaging Het
Cemip T C 7: 83,947,160 D1132G probably damaging Het
Cyth3 T A 5: 143,701,589 probably null Het
Dcpp2 A G 17: 23,900,692 E160G possibly damaging Het
Dock10 C T 1: 80,528,649 G1726S probably null Het
Dsel T C 1: 111,861,707 D366G probably damaging Het
Ednrb A T 14: 103,821,705 L295Q probably damaging Het
Etaa1 C T 11: 17,945,690 R809K probably benign Het
Fahd1 A G 17: 24,849,890 L71P probably damaging Het
Fat1 A G 8: 45,039,956 E3882G probably null Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gba2 T G 4: 43,568,510 D652A probably damaging Het
Gm15448 T C 7: 3,822,904 E322G unknown Het
Gm5460 C T 14: 34,045,919 P220S probably damaging Het
Gm7137 A T 10: 77,787,951 C84S unknown Het
Gm8122 G T 14: 43,232,717 probably null Het
Hist1h1e T C 13: 23,621,939 S187G probably benign Het
Hyal5 A T 6: 24,876,880 I251L probably benign Het
Igkc C A 6: 70,726,682 N82K Het
Il18 T A 9: 50,575,316 M15K possibly damaging Het
Insr T A 8: 3,158,702 E1253V probably benign Het
Itgax A G 7: 128,130,918 Q82R probably benign Het
Kcnn3 A G 3: 89,661,241 I609V probably benign Het
Klk14 A G 7: 43,694,074 D110G probably damaging Het
Lamb3 T A 1: 193,334,248 L679Q probably damaging Het
Lgsn C T 1: 31,196,800 A115V probably benign Het
Lipt1 C T 1: 37,875,625 T254M probably damaging Het
Lrrc3b T C 14: 15,358,004 T201A probably damaging Het
Lrrc49 T A 9: 60,610,330 D432V probably benign Het
Mfi2 A G 16: 31,887,415 N239S probably benign Het
Mki67 G A 7: 135,698,121 A1728V probably benign Het
Mms22l T A 4: 24,536,375 L615I probably damaging Het
Mttp C A 3: 138,123,848 G93V probably benign Het
Muc4 A T 16: 32,755,327 T1734S unknown Het
Myh9 C T 15: 77,764,547 R1703Q possibly damaging Het
N4bp1 T C 8: 86,844,687 *894W probably null Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Nup43 C T 10: 7,676,333 A295V probably benign Het
Olfr1047 C T 2: 86,228,965 G2E probably benign Het
Olfr1158 C T 2: 87,990,152 L14F probably damaging Het
Olfr1271 T C 2: 90,266,043 H129R probably benign Het
Olfr366 T C 2: 37,219,779 C97R probably benign Het
Olfr851 G T 9: 19,497,021 S91I probably damaging Het
Pcdha11 A G 18: 37,006,571 T418A probably benign Het
Pdzd2 T C 15: 12,592,163 K132E probably damaging Het
Plec C T 15: 76,178,297 R2480H possibly damaging Het
Plscr2 G A 9: 92,295,660 G293D probably damaging Het
Ptchd4 A G 17: 42,502,663 H485R probably benign Het
Rbbp9 A T 2: 144,548,066 M59K probably null Het
Rest G A 5: 77,282,478 A915T probably benign Het
Rhbdf1 C T 11: 32,214,563 A168T probably benign Het
Scamp2 A T 9: 57,577,670 Q53L probably benign Het
Scn2a1 T C 2: 65,690,276 F539L probably benign Het
Sdr16c6 A T 4: 4,076,872 I9N probably benign Het
Slc23a3 T A 1: 75,133,867 probably benign Het
Slc6a19 A G 13: 73,685,770 S390P probably damaging Het
Snx11 C T 11: 96,771,059 R99Q probably damaging Het
Soga3 C T 10: 29,147,268 Q204* probably null Het
Suclg2 T A 6: 95,588,946 I189F possibly damaging Het
Timeless A T 10: 128,246,396 R598W probably damaging Het
Tm9sf3 A T 19: 41,215,087 N583K possibly damaging Het
Tox3 A G 8: 90,258,080 V157A probably damaging Het
Tpr G T 1: 150,432,413 V1640L probably benign Het
Trav7-4 C T 14: 53,461,645 A83V probably benign Het
Trdn A G 10: 33,450,985 K590R possibly damaging Het
Trim11 T C 11: 58,990,394 L371P probably damaging Het
Trim5 T A 7: 104,276,826 Q176L probably damaging Het
Tubgcp2 T C 7: 140,006,140 H412R possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Ush2a T A 1: 188,728,666 V2708E probably damaging Het
Vmn1r87 T A 7: 13,131,500 T287S possibly damaging Het
Zbtb7a A G 10: 81,145,004 D344G probably damaging Het
Zfp560 G T 9: 20,349,052 N171K probably benign Het
Zfp579 A T 7: 4,993,851 C354S probably benign Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 splice site probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3884:Igf2r UTSW 17 12709468 missense probably benign
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4021:Igf2r UTSW 17 12748751 missense probably damaging 0.97
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4826:Igf2r UTSW 17 12701353 missense probably damaging 0.98
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7030:Igf2r UTSW 17 12733866 missense probably damaging 1.00
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
R7619:Igf2r UTSW 17 12698273 missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12735991 missense probably damaging 0.98
R7733:Igf2r UTSW 17 12739369 missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12748704 missense probably benign
R8022:Igf2r UTSW 17 12718795 missense probably damaging 1.00
R8138:Igf2r UTSW 17 12701238 missense probably benign 0.32
R8305:Igf2r UTSW 17 12733860 missense probably benign
R8359:Igf2r UTSW 17 12683861 missense probably benign
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Z1177:Igf2r UTSW 17 12697399 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCATGCACAAAGTCCCAGG -3'
(R):5'- ATTGAATGCTTTCCCAGGAGG -3'

Sequencing Primer
(F):5'- AAAGTCCCAGGACCCCGTG -3'
(R):5'- CTGAGGAACTGAGTTTGTAAGTG -3'
Posted On2020-07-13