Incidental Mutation 'R8220:Ptchd4'
ID636663
Institutional Source Beutler Lab
Gene Symbol Ptchd4
Ensembl Gene ENSMUSG00000042256
Gene Namepatched domain containing 4
Synonyms3110082D06Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028474.1; MGI: 1920485

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8220 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location42315947-42507741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42502663 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 485 (H485R)
Ref Sequence ENSEMBL: ENSMUSP00000047640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048691]
Predicted Effect probably benign
Transcript: ENSMUST00000048691
AA Change: H485R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047640
Gene: ENSMUSG00000042256
AA Change: H485R

DomainStartEndE-ValueType
Pfam:Patched 58 867 6.1e-102 PFAM
Pfam:Sterol-sensing 312 464 2.9e-26 PFAM
low complexity region 869 891 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,835 C106S probably damaging Het
4930427A07Rik T C 12: 113,156,755 probably null Het
7420426K07Rik A G 9: 98,903,528 D82G probably benign Het
Abca13 C T 11: 9,434,299 T3917M possibly damaging Het
Abcb8 T C 5: 24,406,785 I533T possibly damaging Het
Becn1 C T 11: 101,296,279 R78Q possibly damaging Het
Bhlha9 T C 11: 76,672,877 I110T probably damaging Het
Cemip T C 7: 83,947,160 D1132G probably damaging Het
Cyth3 T A 5: 143,701,589 probably null Het
Dcpp2 A G 17: 23,900,692 E160G possibly damaging Het
Dock10 C T 1: 80,528,649 G1726S probably null Het
Dsel T C 1: 111,861,707 D366G probably damaging Het
Ednrb A T 14: 103,821,705 L295Q probably damaging Het
Etaa1 C T 11: 17,945,690 R809K probably benign Het
Fahd1 A G 17: 24,849,890 L71P probably damaging Het
Fat1 A G 8: 45,039,956 E3882G probably null Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gba2 T G 4: 43,568,510 D652A probably damaging Het
Gm15448 T C 7: 3,822,904 E322G unknown Het
Gm5460 C T 14: 34,045,919 P220S probably damaging Het
Gm7137 A T 10: 77,787,951 C84S unknown Het
Gm8122 G T 14: 43,232,717 probably null Het
Hist1h1e T C 13: 23,621,939 S187G probably benign Het
Hyal5 A T 6: 24,876,880 I251L probably benign Het
Igf2r A T 17: 12,692,071 S1953R probably benign Het
Igkc C A 6: 70,726,682 N82K Het
Il18 T A 9: 50,575,316 M15K possibly damaging Het
Insr T A 8: 3,158,702 E1253V probably benign Het
Itgax A G 7: 128,130,918 Q82R probably benign Het
Kcnn3 A G 3: 89,661,241 I609V probably benign Het
Klk14 A G 7: 43,694,074 D110G probably damaging Het
Lamb3 T A 1: 193,334,248 L679Q probably damaging Het
Lgsn C T 1: 31,196,800 A115V probably benign Het
Lipt1 C T 1: 37,875,625 T254M probably damaging Het
Lrrc3b T C 14: 15,358,004 T201A probably damaging Het
Lrrc49 T A 9: 60,610,330 D432V probably benign Het
Mfi2 A G 16: 31,887,415 N239S probably benign Het
Mki67 G A 7: 135,698,121 A1728V probably benign Het
Mms22l T A 4: 24,536,375 L615I probably damaging Het
Mttp C A 3: 138,123,848 G93V probably benign Het
Muc4 A T 16: 32,755,327 T1734S unknown Het
Myh9 C T 15: 77,764,547 R1703Q possibly damaging Het
N4bp1 T C 8: 86,844,687 *894W probably null Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Nup43 C T 10: 7,676,333 A295V probably benign Het
Olfr1047 C T 2: 86,228,965 G2E probably benign Het
Olfr1158 C T 2: 87,990,152 L14F probably damaging Het
Olfr1271 T C 2: 90,266,043 H129R probably benign Het
Olfr366 T C 2: 37,219,779 C97R probably benign Het
Olfr851 G T 9: 19,497,021 S91I probably damaging Het
Pcdha11 A G 18: 37,006,571 T418A probably benign Het
Pdzd2 T C 15: 12,592,163 K132E probably damaging Het
Plec C T 15: 76,178,297 R2480H possibly damaging Het
Plscr2 G A 9: 92,295,660 G293D probably damaging Het
Rbbp9 A T 2: 144,548,066 M59K probably null Het
Rest G A 5: 77,282,478 A915T probably benign Het
Rhbdf1 C T 11: 32,214,563 A168T probably benign Het
Scamp2 A T 9: 57,577,670 Q53L probably benign Het
Scn2a1 T C 2: 65,690,276 F539L probably benign Het
Sdr16c6 A T 4: 4,076,872 I9N probably benign Het
Slc23a3 T A 1: 75,133,867 probably benign Het
Slc6a19 A G 13: 73,685,770 S390P probably damaging Het
Snx11 C T 11: 96,771,059 R99Q probably damaging Het
Soga3 C T 10: 29,147,268 Q204* probably null Het
Suclg2 T A 6: 95,588,946 I189F possibly damaging Het
Timeless A T 10: 128,246,396 R598W probably damaging Het
Tm9sf3 A T 19: 41,215,087 N583K possibly damaging Het
Tox3 A G 8: 90,258,080 V157A probably damaging Het
Tpr G T 1: 150,432,413 V1640L probably benign Het
Trav7-4 C T 14: 53,461,645 A83V probably benign Het
Trdn A G 10: 33,450,985 K590R possibly damaging Het
Trim11 T C 11: 58,990,394 L371P probably damaging Het
Trim5 T A 7: 104,276,826 Q176L probably damaging Het
Tubgcp2 T C 7: 140,006,140 H412R possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Ush2a T A 1: 188,728,666 V2708E probably damaging Het
Vmn1r87 T A 7: 13,131,500 T287S possibly damaging Het
Zbtb7a A G 10: 81,145,004 D344G probably damaging Het
Zfp560 G T 9: 20,349,052 N171K probably benign Het
Zfp579 A T 7: 4,993,851 C354S probably benign Het
Other mutations in Ptchd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ptchd4 APN 17 42316926 nonsense probably null
IGL01360:Ptchd4 APN 17 42317045 missense probably benign 0.09
IGL01814:Ptchd4 APN 17 42503286 missense possibly damaging 0.84
IGL01885:Ptchd4 APN 17 42503602 missense probably damaging 1.00
IGL01929:Ptchd4 APN 17 42503322 missense probably benign 0.02
IGL02371:Ptchd4 APN 17 42316974 missense possibly damaging 0.83
IGL02480:Ptchd4 APN 17 42502540 missense probably benign 0.38
IGL02507:Ptchd4 APN 17 42316873 missense possibly damaging 0.72
IGL02593:Ptchd4 APN 17 42317146 missense probably benign 0.24
IGL02861:Ptchd4 APN 17 42377317 missense probably damaging 1.00
IGL02884:Ptchd4 APN 17 42502449 missense possibly damaging 0.86
IGL03384:Ptchd4 APN 17 42502590 missense probably damaging 1.00
PIT4418001:Ptchd4 UTSW 17 42503089 missense probably damaging 1.00
R0030:Ptchd4 UTSW 17 42317108 nonsense probably null
R0243:Ptchd4 UTSW 17 42503416 missense probably damaging 1.00
R0398:Ptchd4 UTSW 17 42377259 missense possibly damaging 0.95
R0513:Ptchd4 UTSW 17 42503746 missense probably benign 0.14
R0630:Ptchd4 UTSW 17 42377185 missense probably benign 0.17
R0662:Ptchd4 UTSW 17 42502576 missense probably damaging 1.00
R1004:Ptchd4 UTSW 17 42377602 missense probably benign 0.00
R1433:Ptchd4 UTSW 17 42503715 missense possibly damaging 0.75
R1451:Ptchd4 UTSW 17 42502918 missense probably damaging 0.99
R1522:Ptchd4 UTSW 17 42503542 missense probably damaging 1.00
R1901:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R1902:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R2135:Ptchd4 UTSW 17 42317074 missense probably benign 0.01
R3935:Ptchd4 UTSW 17 42503489 missense possibly damaging 0.80
R4184:Ptchd4 UTSW 17 42502759 missense probably damaging 0.99
R4552:Ptchd4 UTSW 17 42502455 missense probably benign 0.00
R4573:Ptchd4 UTSW 17 42502777 missense probably benign 0.26
R5100:Ptchd4 UTSW 17 42503676 missense possibly damaging 0.59
R5640:Ptchd4 UTSW 17 42503135 missense possibly damaging 0.73
R6213:Ptchd4 UTSW 17 42377360 missense probably benign 0.00
R6704:Ptchd4 UTSW 17 42317040 missense probably benign 0.00
R7011:Ptchd4 UTSW 17 42503868 missense probably benign 0.19
R7017:Ptchd4 UTSW 17 42502735 missense probably damaging 1.00
R7185:Ptchd4 UTSW 17 42503188 missense probably damaging 1.00
R8112:Ptchd4 UTSW 17 42503175 missense probably benign 0.25
R8153:Ptchd4 UTSW 17 42503896 missense probably benign 0.31
X0062:Ptchd4 UTSW 17 42377464 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCACAAACATAGAGGCCGTG -3'
(R):5'- ATGCTGGCTCCATCACTGATC -3'

Sequencing Primer
(F):5'- CATAGAGGCCGTGAAGATCTTCTGTC -3'
(R):5'- GGCTCCATCACTGATCTGCAAG -3'
Posted On2020-07-13